Regulog RbkR - Halobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | |
| Biological process: | Riboflavin biosynthesis |
| Effector: | Flavin mononucleotide |
| Phylum: | Euryarchaeota |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Halobacteriales
- By trascription factor - RbkR
- By TF family - [Other]
- By effector - Flavin mononucleotide
- By pathway - Riboflavin biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Haloarcula marismortui ATCC 43049 | 2 | 1 |
| Halobacterium salinarum R1 | 2 | 1 |
| Halobacterium sp. NRC-1 | 2 | 1 |
| Haloferax volcanii DS2 | 2 | 1 |
| Halomicrobium mukohataei DSM 12286 | 2 | 1 |
| Haloquadratum walsbyi DSM 16790 | 2 | 1 |
| Halorhabdus utahensis DSM 12940 | ||
| Halorubrum lacusprofundi ATCC 49239 | 2 | 1 |
| Haloterrigena turkmenica DSM 5511 | 2 | 1 |
| Natrialba magadii ATCC 43099 | 2 | 1 |
| Natronomonas pharaonis DSM 2160 | 2 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| rbkR |
*
Haloarcula marismortui ATCC 43049 Site: position = 215 score = 5.60095 sequence = GCATTCCACCTTCGGTATGC Site: position = 197 score = 4.60907 sequence = CCGTTCCAAAAGTGGAATGC Gene: rrnAC3074: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
*
Halobacterium salinarum R1 Site: position = -49 score = 5.20499 sequence = GCATTCCACTTTCGGTATCC Gene: OE3964R: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
*
Halobacterium sp. NRC-1 Site: position = -22 score = 5.20499 sequence = GCATTCCACTTTCGGTATCC Gene: VNG2126C: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
*
Haloferax volcanii DS2 Site: position = -49 score = 4.92893 sequence = GCATTCCACTTACGATACGC Gene: HVO_0326: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
*
Halomicrobium mukohataei DSM 12286 Site: position = -49 score = 5.01222 sequence = GGATGACACATTCGTTATCC Gene: Hmuk_1112: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
*
Haloquadratum walsbyi DSM 16790 Site: position = -49 score = 4.87723 sequence = GCATTCCATGTTCGTTATTC Gene: HQ3236A: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
|
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -67 score = 4.30568 sequence = GGTTAACGTTTTTGGGATGC Site: position = -49 score = 4.88892 sequence = GCATCTCACATCCGTTACTC Gene: Hlac_0355: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
*
Haloterrigena turkmenica DSM 5511 Site: position = -67 score = 4.54427 sequence = CCATCACAGTTTTGGTACGC Site: position = -49 score = 6.03131 sequence = GCATGCCACATTCGGTATGC Gene: Htur_2982: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
*
Natrialba magadii ATCC 43099 Site: position = -67 score = 4.39929 sequence = CCATAACAGTTCTGTGATGC Site: position = -49 score = 5.76313 sequence = GCGTACCACATTCGGTACGC Gene: Nmag_0941: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
*
Natronomonas pharaonis DSM 2160 Site: position = -49 score = 5.00593 sequence = CCATACCACATTCGTTACGG Gene: NP0072A: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase |
| ribB |
Gene: rrnAC3073: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
Gene: OE3963R: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
Gene: VNG2125Gm: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
Gene: HVO_0327: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
Gene: Hmuk_1111: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
Gene: HQ3235A: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
|
Gene: Hlac_0354: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
Gene: Htur_2983: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
Gene: Nmag_0942: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
Gene: NP0074A: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
3,4-dihydroxy-2-butanone 4-phosphate synthase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |