Regulon of RbkR in Halobacterium salinarum R1
Regulator type: | Transcription factor |
TF locus tag: | OE3964R |
Regulator family: | [Other] |
Regulation mode: | |
Biological process: | Riboflavin biosynthesis |
Effector: | Flavin mononucleotide |
Regulog: | RbkR - Halobacteriales |
Statistics of regulated genes: | |
- Genes | 2 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Halobacteriales
- By trascription factor - RbkR
- By TF family - [Other]
- By effector - Flavin mononucleotide
- By pathway - Riboflavin biosynthesis
Locus Tag | Name | Function | |
---|---|---|---|
Position: -49
Score: 5.2 Sequence: GCATTCCACTTTCGGTATCC
Locus tag: OE3964R
Name: rbkR Funciton: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
Locus tag: OE3963R
Name: ribB Funciton: 3,4-dihydroxy-2-butanone 4-phosphate synthase |
|||
rbkR
|
DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
|
||
ribB
|
3,4-dihydroxy-2-butanone 4-phosphate synthase
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |