Regulon of RbkR in Halomicrobium mukohataei DSM 12286

Properties
Regulator type:	Transcription factor
TF locus tag:	Hmuk_1112
Regulator family:	[Other]
Regulation mode:
Biological process:	Riboflavin biosynthesis
Effector:	Flavin mononucleotide
Regulog:	RbkR - Halobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Halobacteriales
By trascription factor - RbkR
By TF family - [Other]
By effector - Flavin mononucleotide
By pathway - Riboflavin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5 Sequence: GGATGACACATTCGTTATCC Locus tag: Hmuk_1112 Name: rbkR Funciton: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase Locus tag: Hmuk_1111 Name: ribB Funciton: 3,4-dihydroxy-2-butanone 4-phosphate synthase
	Hmuk_1112	rbkR	DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
	Hmuk_1111	ribB	3,4-dihydroxy-2-butanone 4-phosphate synthase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD