Regulog MsmR - Bifidobacteriaceae

Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
Genome | Genes | Operons |
---|---|---|
Bifidobacterium longum subsp. infantis ATCC 15697 | 5 | 2 |
Bifidobacterium adolescentis ATCC 15703 | 5 | 2 |
Bifidobacterium angulatum DSM 20098 | 2 | 2 |
Bifidobacterium animalis subsp. lactis AD011 | ||
Bifidobacterium bifidum NCIMB 41171 | ||
Bifidobacterium breve DSM 20213 | ||
Bifidobacterium dentium Bd1 | 3 | 2 |
Bifidobacterium gallicum DSM 20093 | ||
Bifidobacterium longum NCC2705 | ||
Gardnerella vaginalis 409-05 |
Genes | Function | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||
msmR |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -162 score = 5.74008 sequence = TTAGTGAAACGTTTCGACGA Site: position = -149 score = 5.51724 sequence = TCGACGAAACGATTCGATAA Gene: Blon_0042: Multiple sugar utilization transcriptional regulator MsmR, LacI family |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -70 score = 5.89076 sequence = TAAGTGAAACGTTTCGACGA Site: position = -57 score = 5.51724 sequence = TCGACGAAACGATTCGATAA Gene: BAD_1584: Multiple sugar utilization transcriptional regulator MsmR, LacI family |
*
Bifidobacterium angulatum DSM 20098 Site: position = -132 score = 5.89076 sequence = TAAGTGAAACGTTTCGACGA Site: position = -119 score = 5.2354 sequence = TCGACGAAACGATTCGACAA Gene: BIFANG_01794: Multiple sugar utilization transcriptional regulator MsmR, LacI family |
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -71 score = 6.29921 sequence = TTATTGAAACGTTTCGACGA Site: position = -58 score = 5.66791 sequence = TCGACGAAACGATTCGATTA Gene: BDP_2166: Multiple sugar utilization transcriptional regulator MsmR, LacI family |
|
|
|
Multiple sugar utilization transcriptional regulator MsmR, LacI family |
CRON 2. | |||||||||||
msmE |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -196 score = 6.01764 sequence = TAATCGAAACGATTCGAAAG Site: position = -108 score = 6.10343 sequence = TCGTCGAAACGTTTCGAAAA Gene: Blon_0043: Multiple sugar ABC transporter, substrate-binding protein |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -186 score = 6.73173 sequence = TAATCGAAACGTTTCAATGA Site: position = -78 score = 6.04557 sequence = TCATCGAAACGTTTCAATAC Gene: BAD_1585: Multiple sugar ABC transporter, substrate-binding protein |
*
Bifidobacterium angulatum DSM 20098 Site: position = -168 score = 5.53742 sequence = AAATCGAAACGATTCGATAT Site: position = -85 score = 6.98191 sequence = TAATCGAAACGTTTCAATTA Gene: BIFANG_01793: Multiple sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
Multiple sugar ABC transporter, substrate-binding protein |
msmG |
Gene: Blon_0044: Multiple sugar ABC transporter, permease protein 1 |
Gene: BAD_1586: Multiple sugar ABC transporter, permease protein 1 |
Gene: BIFANG_01791: Multiple sugar ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
Multiple sugar ABC transporter, permease protein 1 |
msmF |
Gene: Blon_0045: Multiple sugar ABC transporter, permease protein 2 |
Gene: BAD_1587: Multiple sugar ABC transporter, permease protein 2 |
Gene: BIFANG_01790: Multiple sugar ABC transporter, permease protein 2 |
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -242 score = 6.54939 sequence = TAATCGAAACGTTTCAACAA Gene: BDP_2164: Multiple sugar ABC transporter, permease protein 2 |
|
|
|
Multiple sugar ABC transporter, permease protein 2 |
PF11175 |
Gene: Blon_0046: Protein of unknown function (DUF2961) |
Gene: BAD_1588: Protein of unknown function (DUF2961) |
Gene: BIFANG_01789: Protein of unknown function (DUF2961) |
|
|
|
Gene: BDP_2163: Protein of unknown function (DUF2961) |
|
|
|
Protein of unknown function (DUF2961) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |