Orthologous regulated operons containing PF11175 gene

Properties
Regulog:	MsmR - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Phylum:	Actinobacteria

Built upon 15 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -186 Score: 6.73173 Sequence: TAATCGAAACGTTTCAATGA Position: -78 Score: 6.04557 Sequence: TCATCGAAACGTTTCAATAC Locus tag: BAD_1585 Name: msmE Funciton: Multiple sugar ABC transporter, substrate-binding protein Locus tag: BAD_1586 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 1 Locus tag: BAD_1587 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 2 Locus tag: BAD_1588 Name: PF11175 Funciton: Protein of unknown function (DUF2961)
msmE-msmF-msmF-PF11175	-186	6.7	TAATCGAAACGTTTCAATGA	BAD_1585
	-78	6	TCATCGAAACGTTTCAATAC
Bifidobacterium dentium Bd1
Position: -242 Score: 6.54939 Sequence: TAATCGAAACGTTTCAACAA Locus tag: BDP_2164 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 2 Locus tag: BDP_2163 Name: PF11175 Funciton: Protein of unknown function (DUF2961)
msmF-PF11175	-242	6.5	TAATCGAAACGTTTCAACAA	BDP_2164
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -196 Score: 6.01764 Sequence: TAATCGAAACGATTCGAAAG Position: -108 Score: 6.10343 Sequence: TCGTCGAAACGTTTCGAAAA Locus tag: Blon_0043 Name: msmE Funciton: Multiple sugar ABC transporter, substrate-binding protein Locus tag: Blon_0044 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 1 Locus tag: Blon_0045 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 2 Locus tag: Blon_0046 Name: PF11175 Funciton: Protein of unknown function (DUF2961)
msmE-msmF-msmF-PF11175	-196	6	TAATCGAAACGATTCGAAAG	Blon_0043
	-108	6.1	TCGTCGAAACGTTTCGAAAA