Regulon of MsmR in Bifidobacterium adolescentis ATCC 15703

Properties
Regulator type:	Transcription factor
TF locus tag:	BAD_1584
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	MsmR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -186 Score: 6.7 Sequence: TAATCGAAACGTTTCAATGA Position: -78 Score: 6 Sequence: TCATCGAAACGTTTCAATAC Locus tag: BAD_1585 Name: msmE Funciton: Multiple sugar ABC transporter, substrate-binding protein Locus tag: BAD_1586 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 1 Locus tag: BAD_1587 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 2 Locus tag: BAD_1588 Name: PF11175 Funciton: Protein of unknown function (DUF2961)
	BAD_1585	msmE	Multiple sugar ABC transporter, substrate-binding protein
	BAD_1586	msmF	Multiple sugar ABC transporter, permease protein 1
	BAD_1587	msmF	Multiple sugar ABC transporter, permease protein 2
	BAD_1588	PF11175	Protein of unknown function (DUF2961)
Position: -70 Score: 5.9 Sequence: TAAGTGAAACGTTTCGACGA Position: -57 Score: 5.5 Sequence: TCGACGAAACGATTCGATAA Locus tag: BAD_1584 Name: msmR Funciton: Multiple sugar utilization transcriptional regulator MsmR, LacI family
	BAD_1584	msmR	Multiple sugar utilization transcriptional regulator MsmR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD