Regulon of MsmR in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type:	Transcription factor
TF locus tag:	Blon_0042
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	MsmR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -196 Score: 6 Sequence: TAATCGAAACGATTCGAAAG Position: -108 Score: 6.1 Sequence: TCGTCGAAACGTTTCGAAAA Locus tag: Blon_0043 Name: msmE Funciton: Multiple sugar ABC transporter, substrate-binding protein Locus tag: Blon_0044 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 1 Locus tag: Blon_0045 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 2 Locus tag: Blon_0046 Name: PF11175 Funciton: Protein of unknown function (DUF2961)
	Blon_0043	msmE	Multiple sugar ABC transporter, substrate-binding protein
	Blon_0044	msmF	Multiple sugar ABC transporter, permease protein 1
	Blon_0045	msmF	Multiple sugar ABC transporter, permease protein 2
	Blon_0046	PF11175	Protein of unknown function (DUF2961)
Position: -162 Score: 5.7 Sequence: TTAGTGAAACGTTTCGACGA Position: -149 Score: 5.5 Sequence: TCGACGAAACGATTCGATAA Locus tag: Blon_0042 Name: msmR Funciton: Multiple sugar utilization transcriptional regulator MsmR, LacI family
	Blon_0042	msmR	Multiple sugar utilization transcriptional regulator MsmR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD