Regulon of MsmR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_2166
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	MsmR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -242 Score: 6.5 Sequence: TAATCGAAACGTTTCAACAA Locus tag: BDP_2164 Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 2 Locus tag: BDP_2163 Name: PF11175 Funciton: Protein of unknown function (DUF2961)
	BDP_2164	msmF	Multiple sugar ABC transporter, permease protein 2
	BDP_2163	PF11175	Protein of unknown function (DUF2961)
Position: -71 Score: 6.3 Sequence: TTATTGAAACGTTTCGACGA Position: -58 Score: 5.7 Sequence: TCGACGAAACGATTCGATTA Locus tag: BDP_2166 Name: msmR Funciton: Multiple sugar utilization transcriptional regulator MsmR, LacI family
	BDP_2166	msmR	Multiple sugar utilization transcriptional regulator MsmR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD