Regulog GosR - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Galactooligosaccharide utilization; Galactan utilization |
| Effector: | Galactobiose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Galactobiose
- By pathway - Galactooligosaccharide utilization
- By pathway - Galactan utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | 6 | 2 |
| Bifidobacterium angulatum DSM 20098 | 3 | 1 |
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | 3 | 1 |
| Bifidobacterium breve DSM 20213 | 1 | 1 |
| Bifidobacterium dentium Bd1 | 5 | 3 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | 2 | 2 |
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| gosB2 |
|
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -159 score = 5.27321 sequence = CAGGTACACAGTTATACCAA Site: position = -190 score = 4.85253 sequence = ATGGTACACCGGAAAACCTA Gene: BAD_1405: Putative galactooligosaccharide ABC transporter, sugar-binding protein |
|
|
|
|
|
|
|
|
Putative galactooligosaccharide ABC transporter, sugar-binding protein |
| gosC2 |
|
Gene: BAD_1404: Putative galactooligosaccharide ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
|
Putative galactooligosaccharide ABC transporter, permease protein 1 |
| gosD2 |
|
Gene: BAD_1403: Putative galactooligosaccharide ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
Putative galactooligosaccharide ABC transporter, permease protein 2 |
| bgaB2 |
|
Gene: BAD_1402: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
|
|
|
|
|
Beta-galactosidase (EC 3.2.1.23) |
| CRON 2. | |||||||||||
| galA |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -29 score = 5.75047 sequence = TTGGTACAACGGTGTCTCTA Gene: BDP_2054: Arabinogalactan endo-beta-1,4-galactanase (EC 3.2.1.89) |
|
*
Bifidobacterium longum NCC2705 Site: position = -97 score = 4.95726 sequence = GTGGTACACAGCTGTACCGC Site: position = -147 score = 5.84454 sequence = TTGATACACCGGTTGACCAA Gene: BL0257: Arabinogalactan endo-beta-1,4-galactanase (EC 3.2.1.89) |
|
Arabinogalactan endo-beta-1,4-galactanase (EC 3.2.1.89) |
| CRON 3. | |||||||||||
| BbifN4_010100001412 |
|
|
|
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -39 score = 4.88967 sequence = CTGGTATAGCGGTGCATCAT Site: position = -11 score = 6.09143 sequence = TTGATACTCCGTTGTATCAA Gene: BbifN4_010100001412: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| BbifN4_010100001417 |
|
|
|
|
Gene: BbifN4_010100001417: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| PF00248 |
Gene: Blon_0442: Aldo/keto reductase |
Gene: BAD_1396: Aldo/keto reductase |
Gene: BIFANG_00154: Aldo/keto reductase |
Gene: BLA_0059: Aldo/keto reductase |
Gene: BbifN4_010100001422: Aldo/keto reductase |
Gene: BIFBRE_02227: Aldo/keto reductase |
Gene: BDP_1903: Aldo/keto reductase |
Gene: BIFGAL_00641: Aldo/keto reductase |
Gene: BL0255: Aldo/keto reductase |
|
Aldo/keto reductase |
| bgaB |
Gene: Blon_2123: Beta-galactosidase (EC 3.2.1.23), GH42 family |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -60 score = 6.05088 sequence = ATGCTACACCGGTGTACCAC Gene: BAD_1401: Beta-galactosidase (EC 3.2.1.23), GH42 family |
*
Bifidobacterium angulatum DSM 20098 Site: position = 17 score = 5.88674 sequence = GTGGTACAACTGTGTATCAT Gene: BIFANG_00156: Beta-galactosidase (EC 3.2.1.23), GH42 family |
|
Gene: BbifN4_010100000420: Beta-galactosidase (EC 3.2.1.23), GH42 family |
Gene: BIFBRE_02225: Beta-galactosidase (EC 3.2.1.23), GH42 family |
*
Bifidobacterium dentium Bd1 Site: position = -72 score = 6.1572 sequence = TTGCTACACCGTTGTATCAT Gene: BDP_1908: Beta-galactosidase (EC 3.2.1.23), GH42 family |
|
Gene: BL0259: Beta-galactosidase (EC 3.2.1.23), GH42 family |
|
Beta-galactosidase (EC 3.2.1.23), GH42 family |
| gosR |
Gene: Blon_0439: Predicted transcriptional regulator of galactan utilization, LacI family |
Gene: BAD_1400: Predicted transcriptional regulator of galactan utilization, LacI family |
Gene: BIFANG_00155: Predicted transcriptional regulator of galactan utilization, LacI family |
|
Gene: BbifN4_010100001407: Predicted transcriptional regulator of galactan utilization, LacI family |
Gene: BIFBRE_02226: Predicted transcriptional regulator of galactan utilization, LacI family |
Gene: BDP_1907: Predicted transcriptional regulator of galactan utilization, LacI family |
|
Gene: BL0258: Predicted transcriptional regulator of galactan utilization, LacI family |
|
Predicted transcriptional regulator of galactan utilization, LacI family |
| CRON 4. | |||||||||||
| gosB |
|
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -260 score = 6.32638 sequence = TTGGTACACAGGTGTATCAT Site: position = -232 score = 5.58617 sequence = TTGGTACATGGGTGTACCAA Gene: BIFBRE_02223: Putative galactooligosaccharide ABC transporter, substrate-binding component |
*
Bifidobacterium dentium Bd1 Site: position = -216 score = 5.94546 sequence = TTGATACAGCTGTGTATCAT Site: position = -188 score = 5.8045 sequence = ATGATACACAGTTGTATCAG Site: position = -98 score = 5.97821 sequence = TTGGTACAGCGGTATATCAA Gene: BDP_1911: Putative galactooligosaccharide ABC transporter, substrate-binding component |
|
*
Bifidobacterium longum NCC2705 Site: position = -253 score = 6.12709 sequence = TTGGTACACGGGTGTACCAA Site: position = -281 score = 6.32638 sequence = TTGGTACACAGGTGTATCAT Gene: BL0262: Putative galactooligosaccharide ABC transporter, substrate-binding component |
|
Putative galactooligosaccharide ABC transporter, substrate-binding component |
| gosC |
|
|
|
|
|
|
Gene: BDP_1910: Putative galactooligosaccharide ABC transporter, permease component 1 |
|
Gene: BL0261: Putative galactooligosaccharide ABC transporter, permease component 1 |
|
Putative galactooligosaccharide ABC transporter, permease component 1 |
| gosD |
|
|
|
|
|
|
Gene: BDP_1909: Putative galactooligosaccharide ABC transporter, permease component 2 |
|
Gene: BL0260: Putative galactooligosaccharide ABC transporter, permease component 2 |
|
Putative galactooligosaccharide ABC transporter, permease component 2 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |