Regulon of GosR in Bifidobacterium adolescentis ATCC 15703

Properties
Regulator type:	Transcription factor
TF locus tag:	BAD_1400
Regulator family:	LacI
Regulation mode:
Biological process:	Galactooligosaccharide utilization; Galactan utilization
Effector:	Galactobiose
Regulog:	GosR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Galactobiose
By pathway - Galactooligosaccharide utilization
By pathway - Galactan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6.1 Sequence: ATGCTACACCGGTGTACCAC Locus tag: BAD_1401 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23), GH42 family Locus tag: BAD_1400 Name: gosR Funciton: Predicted transcriptional regulator of galactan utilization, LacI family
	BAD_1401	bgaB	Beta-galactosidase (EC 3.2.1.23), GH42 family
	BAD_1400	gosR	Predicted transcriptional regulator of galactan utilization, LacI family
Position: -190 Score: 4.9 Sequence: ATGGTACACCGGAAAACCTA Position: -159 Score: 5.3 Sequence: CAGGTACACAGTTATACCAA Locus tag: BAD_1405 Name: gosB2 Funciton: Putative galactooligosaccharide ABC transporter, sugar-binding protein Locus tag: BAD_1404 Name: gosC2 Funciton: Putative galactooligosaccharide ABC transporter, permease protein 1 Locus tag: BAD_1403 Name: gosD2 Funciton: Putative galactooligosaccharide ABC transporter, permease protein 2 Locus tag: BAD_1402 Name: bgaB2 Funciton: Beta-galactosidase (EC 3.2.1.23)
	BAD_1405	gosB2	Putative galactooligosaccharide ABC transporter, sugar-binding protein
	BAD_1404	gosC2	Putative galactooligosaccharide ABC transporter, permease protein 1
	BAD_1403	gosD2	Putative galactooligosaccharide ABC transporter, permease protein 2
	BAD_1402	bgaB2	Beta-galactosidase (EC 3.2.1.23)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD