Regulon of GosR in Bifidobacterium bifidum NCIMB 41171

Properties
Regulator type:	Transcription factor
TF locus tag:	BbifN4_010100001407
Regulator family:	LacI
Regulation mode:
Biological process:	Galactooligosaccharide utilization; Galactan utilization
Effector:	Galactobiose
Regulog:	GosR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Galactobiose
By pathway - Galactooligosaccharide utilization
By pathway - Galactan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 4.9 Sequence: CTGGTATAGCGGTGCATCAT Position: -11 Score: 6.1 Sequence: TTGATACTCCGTTGTATCAA Locus tag: BbifN4_010100001412 Name: null Funciton: hypothetical protein Locus tag: BbifN4_010100001417 Name: null Funciton: hypothetical protein Locus tag: BbifN4_010100001422 Name: PF00248 Funciton: Aldo/keto reductase
	BbifN4_010100001412		hypothetical protein
	BbifN4_010100001417		hypothetical protein
	BbifN4_010100001422	PF00248	Aldo/keto reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD