Regulon of GosR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_1907
Regulator family:	LacI
Regulation mode:
Biological process:	Galactooligosaccharide utilization; Galactan utilization
Effector:	Galactobiose
Regulog:	GosR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Galactobiose
By pathway - Galactooligosaccharide utilization
By pathway - Galactan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6.2 Sequence: TTGCTACACCGTTGTATCAT Locus tag: BDP_1908 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23), GH42 family
	BDP_1908	bgaB	Beta-galactosidase (EC 3.2.1.23), GH42 family
Position: -29 Score: 5.8 Sequence: TTGGTACAACGGTGTCTCTA Locus tag: BDP_2054 Name: galA Funciton: Arabinogalactan endo-beta-1,4-galactanase (EC 3.2.1.89)
	BDP_2054	galA	Arabinogalactan endo-beta-1,4-galactanase (EC 3.2.1.89)
Position: -216 Score: 5.9 Sequence: TTGATACAGCTGTGTATCAT Position: -188 Score: 5.8 Sequence: ATGATACACAGTTGTATCAG Position: -98 Score: 6 Sequence: TTGGTACAGCGGTATATCAA Locus tag: BDP_1911 Name: gosB Funciton: Putative galactooligosaccharide ABC transporter, substrate-binding component Locus tag: BDP_1910 Name: gosC Funciton: Putative galactooligosaccharide ABC transporter, permease component 1 Locus tag: BDP_1909 Name: gosD Funciton: Putative galactooligosaccharide ABC transporter, permease component 2
	BDP_1911	gosB	Putative galactooligosaccharide ABC transporter, substrate-binding component
	BDP_1910	gosC	Putative galactooligosaccharide ABC transporter, permease component 1
	BDP_1909	gosD	Putative galactooligosaccharide ABC transporter, permease component 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD