Regulon of GosR in Bifidobacterium breve DSM 20213

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFBRE_02226
Regulator family:	LacI
Regulation mode:
Biological process:	Galactooligosaccharide utilization; Galactan utilization
Effector:	Galactobiose
Regulog:	GosR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Galactobiose
By pathway - Galactooligosaccharide utilization
By pathway - Galactan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -260 Score: 6.3 Sequence: TTGGTACACAGGTGTATCAT Position: -232 Score: 5.6 Sequence: TTGGTACATGGGTGTACCAA Locus tag: BIFBRE_02223 Name: gosB Funciton: Putative galactooligosaccharide ABC transporter, substrate-binding component
	BIFBRE_02223	gosB	Putative galactooligosaccharide ABC transporter, substrate-binding component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD