Regulog RspR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | L-gulonate utilization |
| Effector: | L-gulonate; D-mannonate |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - GntR/Others
- By effector - L-gulonate
- By effector - D-mannonate
- By pathway - L-gulonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | 7 | 2 |
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | 4 | 1 |
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | 5 | 1 |
| Escherichia coli str. K-12 substr. MG1655 | 2 | 1 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 3 | 2 |
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | 2 | 1 |
| Serratia proteamaculans 568 | 5 | 1 |
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| rspA |
*
Citrobacter koseri ATCC BAA-895 Site: position = -70 score = 5.76572 sequence = TATACTTGTATGGTAGTAGT Gene: CKO_01575: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
|
*
Enterobacter sp. 638 Site: position = -70 score = 5.59139 sequence = AATACTTGTATGGTAGTAGC Gene: Ent638_1932: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -37 score = 5.34206 sequence = TATACTTGTATGGTAGTCAG Gene: ECA0917: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -70 score = 5.82324 sequence = TATACTTGTATGGTAGTAGC Gene: b1581: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
|
|
|
*
Salmonella typhimurium LT2 Site: position = -69 score = 5.82324 sequence = TATACTTGTATGGTAGTAGC Gene: STM1505: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
*
Serratia proteamaculans 568 Site: position = -74 score = 5.2965 sequence = CATACTTGTATGGTAGTTAG Gene: Spro_3563: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
|
D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
| rspB |
Gene: CKO_01574: L-gulonate dehydrogenase, COG1063 family |
|
Gene: Ent638_1933: L-gulonate dehydrogenase, COG1063 family |
|
Gene: ECA0918: L-gulonate dehydrogenase, COG1063 family |
Gene: b1580: L-gulonate dehydrogenase, COG1063 family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -49 score = 5.30871 sequence = CATACTTGTATGGTAATAAA Gene: KPN_03621: L-gulonate dehydrogenase, COG1063 family |
|
|
Gene: STM1506: L-gulonate dehydrogenase, COG1063 family |
Gene: Spro_3564: L-gulonate dehydrogenase, COG1063 family |
|
L-gulonate dehydrogenase, COG1063 family |
| rspC |
Gene: CKO_01573: Putative gulonate transporter, MFS superfamily, COG2271 family |
|
Gene: Ent638_1934: Putative gulonate transporter, MFS superfamily, COG2271 family |
|
Gene: ECA0919: Putative gulonate transporter, MFS superfamily, COG2271 family |
|
Gene: KPN_03622: Putative gulonate transporter, MFS superfamily, COG2271 family |
|
|
|
Gene: Spro_3565: Putative gulonate transporter, MFS superfamily, COG2271 family |
|
Putative gulonate transporter, MFS superfamily, COG2271 family |
| rspD |
2
Citrobacter koseri ATCC BAA-895 Gene: CKO_03733: D-mannonate oxidoreductase (EC 1.1.1.57) Gene: CKO_01572: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
Gene: Ent638_1935: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
Gene: ECA0920: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: b1542: D-mannonate oxidoreductase (EC 1.1.1.57) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -132 score = 5.24367 sequence = TCTTCTTGTATGGTAGTTGA Gene: KPN_01587: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
|
Gene: STM1508: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: Spro_3566: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
D-mannonate oxidoreductase (EC 1.1.1.57) |
| rspR |
Gene: CKO_01570: Transcriptional regulator for L-gulonate utilization, GntR family |
|
Gene: Ent638_1938: Transcriptional regulator for L-gulonate utilization, GntR family |
|
Gene: ECA0921: Transcriptional regulator for L-gulonate utilization, GntR family |
Gene: b1540: Transcriptional regulator for L-gulonate utilization, GntR family |
Gene: KPN_01589: Transcriptional regulator for L-gulonate utilization, GntR family |
|
|
Gene: STM1510: Transcriptional regulator for L-gulonate utilization, GntR family |
Gene: Spro_3567: Transcriptional regulator for L-gulonate utilization, GntR family |
|
Transcriptional regulator for L-gulonate utilization, GntR family |
| uxaC2 |
*
Citrobacter koseri ATCC BAA-895 Site: position = -133 score = 5.60565 sequence = TACACTTGTATGGTAGTAGA Gene: CKO_03735: Uronate isomerase (EC 5.3.1.12) |
|
|
|
|
|
|
|
|
|
|
|
Uronate isomerase (EC 5.3.1.12) |
| COG2211 |
Gene: CKO_03734: Oligogalacturonide transporter |
|
|
|
|
|
|
|
|
|
|
|
Oligogalacturonide transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |