Regulon of RspR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b1540
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	L-gulonate utilization
Effector:	L-gulonate; D-mannonate
Regulog:	RspR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - GntR/Others
By effector - L-gulonate
By effector - D-mannonate
By pathway - L-gulonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 5.8 Sequence: TATACTTGTATGGTAGTAGC Locus tag: b1581 Name: rspA Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family Locus tag: b1580 Name: rspB Funciton: L-gulonate dehydrogenase, COG1063 family
	b1581	rspA	D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
	b1580	rspB	L-gulonate dehydrogenase, COG1063 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD