Regulon of RspR in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type:	Transcription factor
TF locus tag:	ECA0921
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	L-gulonate utilization
Effector:	L-gulonate; D-mannonate
Regulog:	RspR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - GntR/Others
By effector - L-gulonate
By effector - D-mannonate
By pathway - L-gulonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.3 Sequence: TATACTTGTATGGTAGTCAG Locus tag: ECA0917 Name: rspA Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family Locus tag: ECA0918 Name: rspB Funciton: L-gulonate dehydrogenase, COG1063 family Locus tag: ECA0919 Name: rspC Funciton: Putative gulonate transporter, MFS superfamily, COG2271 family Locus tag: ECA0920 Name: rspD Funciton: D-mannonate oxidoreductase (EC 1.1.1.57) Locus tag: ECA0921 Name: rspR Funciton: Transcriptional regulator for L-gulonate utilization, GntR family
	ECA0917	rspA	D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
	ECA0918	rspB	L-gulonate dehydrogenase, COG1063 family
	ECA0919	rspC	Putative gulonate transporter, MFS superfamily, COG2271 family
	ECA0920	rspD	D-mannonate oxidoreductase (EC 1.1.1.57)
	ECA0921	rspR	Transcriptional regulator for L-gulonate utilization, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD