Regulon of RspR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_01589
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	L-gulonate utilization
Effector:	L-gulonate; D-mannonate
Regulog:	RspR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - GntR/Others
By effector - L-gulonate
By effector - D-mannonate
By pathway - L-gulonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -132 Score: 5.2 Sequence: TCTTCTTGTATGGTAGTTGA Locus tag: KPN_01587 Name: rspD Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
	KPN_01587	rspD	D-mannonate oxidoreductase (EC 1.1.1.57)
Position: -49 Score: 5.3 Sequence: CATACTTGTATGGTAATAAA Locus tag: KPN_03621 Name: rspB Funciton: L-gulonate dehydrogenase, COG1063 family Locus tag: KPN_03622 Name: rspC Funciton: Putative gulonate transporter, MFS superfamily, COG2271 family
	KPN_03621	rspB	L-gulonate dehydrogenase, COG1063 family
	KPN_03622	rspC	Putative gulonate transporter, MFS superfamily, COG2271 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD