Statistics of regulated genes

Genome	Genes	Operons
Staphylococcus aureus subsp. aureus N315	5	2
Staphylococcus capitis SK14	3	1
Staphylococcus epidermidis ATCC 12228	8	2
Staphylococcus carnosus subsp. carnosus TM300
Staphylococcus haemolyticus JCSC1435	12	3
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	11	3
Macrococcus caseolyticus JCSC5402	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes								Function
CRON 1.
arsD	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	* Staphylococcus epidermidis ATCC 12228 Site: position = -49 score = 6.41042 sequence = TATATAGATGTTAGTCTATAAT Site: position = -65 score = 5.94069 sequence = AACATAGACATTAATCTATATA Gene: SE0138: arsenical resistance operon trans-acting ArsD	Staphylococcus carnosus subsp. carnosus TM300	* Staphylococcus haemolyticus JCSC1435 Site: position = -213 score = 5.30959 sequence = AATATAAATCAATATCTATATT Site: position = -65 score = 5.13435 sequence = AACATAGACACCAATCTATATA Site: position = -49 score = 6.66533 sequence = TATATAGATGTTAATCTATAAT Gene: SH0112: arsenical resistance operon trans-acting ArsD	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -49 score = 6.12752 sequence = TATATAGATGTTAATCTATGGT Site: position = -65 score = 5.79358 sequence = TACATAGACACTAATCTATATA Gene: SSPP119: arsenical resistance operon trans-acting ArsD	Macrococcus caseolyticus JCSC5402	arsenical resistance operon trans-acting ArsD
arsA	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228 Gene: SE0137: arsenite-transporting ATPase	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435 Gene: SH0111: arsenite-transporting ATPase	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSPP118: arsenite-transporting ATPase	Macrococcus caseolyticus JCSC5402	arsenite-transporting ATPase
SSPP117	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSPP117: putative dehydrogenase	Macrococcus caseolyticus JCSC5402	putative dehydrogenase
arsR	*2 Staphylococcus aureus subsp. aureus N315 Site: position = -56 score = 6.18229 sequence = AATATAGACATTCATCTATATA Site: position = -40 score = 6.8565 sequence = TATATAGATGATAATCTATTTA Gene: SA1591: arsenical resistance operon repressor Site: position = -41 score = 6.7219 sequence = TATATAGATGTTAATCTATTTA Site: position = -57 score = 6.07528 sequence = AACATAGACAATAATCTATATA Gene: SAP016: arsenical resistance operon repressor	* Staphylococcus capitis SK14 Site: position = -42 score = 6.79992 sequence = TATATAGATGATAATCTATAAT Site: position = -58 score = 5.95417 sequence = TATATAGATATTTGTCTATATA Gene: STACA0001_1318: arsenical resistance operon repressor	Staphylococcus epidermidis ATCC 12228 Gene: SE0136: arsenical resistance operon repressor	Staphylococcus carnosus subsp. carnosus TM300	*2 Staphylococcus haemolyticus JCSC1435 Gene: SH0110: arsenical resistance operon repressor Site: position = -42 score = 6.79992 sequence = TATATAGATGATAATCTATAAT Gene: SH0103: arsenical resistance operon repressor	*2 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -40 score = 6.54635 sequence = TATATAGATGTTAGTCTATGTA Site: position = -56 score = 5.37596 sequence = AATATAGACACCAATCTATATA Gene: SSP2384: arsenical resistance operon repressor Gene: SSPP116: arsenical resistance operon repressor	* Macrococcus caseolyticus JCSC5402 Site: position = -46 score = 6.80126 sequence = TATATAGATGTTAATCTATGTA Site: position = -62 score = 5.61829 sequence = TATATAGACACTTATCTATATA Gene: MCCL_1484: arsenical resistance operon repressor	arsenical resistance operon repressor
arsB	2 Staphylococcus aureus subsp. aureus N315 Gene: SA1592: arsenic efflux pump protein Gene: SAP017: arsenic efflux pump protein	Staphylococcus capitis SK14 Gene: STACA0001_1319: arsenical pump membrane protein	Staphylococcus epidermidis ATCC 12228 Gene: SE0135: arsenic efflux pump protein	Staphylococcus carnosus subsp. carnosus TM300	2 Staphylococcus haemolyticus JCSC1435 Gene: SH0109: arsenic efflux pump protein Gene: SH0102: arsenical pump membrane protein	2 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSPP115: arsenic efflux pump protein Gene: SSP2383: arsenic efflux pump protein	Macrococcus caseolyticus JCSC5402 Gene: MCCL_1485: arsenic efflux pump protein	arsenic efflux pump protein
arsC	Staphylococcus aureus subsp. aureus N315 Gene: SAP018: arsenate reductase	Staphylococcus capitis SK14 Gene: STACA0001_1320: arsenate reductase	Staphylococcus epidermidis ATCC 12228 Gene: SE0134: arsenate reductase	Staphylococcus carnosus subsp. carnosus TM300	2 Staphylococcus haemolyticus JCSC1435 Gene: SH0108: arsenate reductase Gene: SH0101: arsenate reductase	2 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSPP114: arsenate reductase Gene: SSP1633: arsenate reductase	Macrococcus caseolyticus JCSC5402 Gene: MCCL_1486: arsenate reductase	arsenate reductase
CRON 2.
SH0113	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	* Staphylococcus haemolyticus JCSC1435 Site: position = -90 score = 5.30959 sequence = AATATAGATATTGATTTATATT Site: position = -238 score = 5.13435 sequence = TATATAGATTGGTGTCTATGTT Site: position = -254 score = 6.66533 sequence = ATTATAGATTAACATCTATATA Gene: SH0113: hypothetical protein	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -241 score = 5.79358 sequence = TATATAGATTAGTGTCTATGTA Site: position = -257 score = 6.12752 sequence = ACCATAGATTAACATCTATATA Gene: SSPP120: hypothetical protein	Macrococcus caseolyticus JCSC5402	hypothetical protein
arsR3	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	* Staphylococcus epidermidis ATCC 12228 Site: position = -332 score = 4.78764 sequence = AATATATATATTGATTTATATT Site: position = -477 score = 5.94069 sequence = TATATAGATTAATGTCTATGTT Site: position = -493 score = 6.41042 sequence = ATTATAGACTAACATCTATATA Gene: SE0139: arsenical resistance operon repressor-like protein	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435 Gene: SH0114: hypothetical protein	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSPP121: arsenical resistance operon repressor-like protein	Macrococcus caseolyticus JCSC5402	arsenical resistance operon repressor-like protein
SE0140	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228 Gene: SE0140: putative permease	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435 Gene: SH0115: putative permease	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSPP122: putative permease	Macrococcus caseolyticus JCSC5402	putative permease
SE0141	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228 Gene: SE0141: hypothetical protein	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435 Gene: SH0116: hypothetical protein	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402	hypothetical protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD