Regulon of ArsR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type:	Transcription factor
TF locus tag:	SAP016, SA1591
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate; Arsenite
Regulog:	ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - ArsR
By effector - Arsenate
By effector - Arsenite
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 6.2 Sequence: AATATAGACATTCATCTATATA Position: -40 Score: 6.9 Sequence: TATATAGATGATAATCTATTTA Locus tag: SA1591 Name: arsR Funciton: arsenical resistance operon repressor Locus tag: SA1592 Name: arsB Funciton: arsenic efflux pump protein
	SA1591	arsR	arsenical resistance operon repressor
	SA1592	arsB	arsenic efflux pump protein
Position: -57 Score: 6.1 Sequence: AACATAGACAATAATCTATATA Position: -41 Score: 6.7 Sequence: TATATAGATGTTAATCTATTTA Locus tag: SAP016 Name: arsR Funciton: arsenical resistance operon repressor Locus tag: SAP017 Name: arsB Funciton: arsenic efflux pump protein Locus tag: SAP018 Name: arsC Funciton: arsenate reductase
	SAP016	arsR	arsenical resistance operon repressor
	SAP017	arsB	arsenic efflux pump protein
	SAP018	arsC	arsenate reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD