Regulon of ArsR in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE0136, SE0139
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate; Arsenite
Regulog:	ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - ArsR
By effector - Arsenate
By effector - Arsenite
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -493 Score: 6.4 Sequence: ATTATAGACTAACATCTATATA Position: -477 Score: 5.9 Sequence: TATATAGATTAATGTCTATGTT Position: -332 Score: 4.8 Sequence: AATATATATATTGATTTATATT Locus tag: SE0139 Name: arsR3 Funciton: arsenical resistance operon repressor-like protein Locus tag: SE0140 Name: SE0140 Funciton: putative permease Locus tag: SE0141 Name: SE0141 Funciton: hypothetical protein
	SE0139	arsR3	arsenical resistance operon repressor-like protein
	SE0140	SE0140	putative permease
	SE0141	SE0141	hypothetical protein
Position: -65 Score: 5.9 Sequence: AACATAGACATTAATCTATATA Position: -49 Score: 6.4 Sequence: TATATAGATGTTAGTCTATAAT Locus tag: SE0138 Name: arsD Funciton: arsenical resistance operon trans-acting ArsD Locus tag: SE0137 Name: arsA Funciton: arsenite-transporting ATPase Locus tag: SE0136 Name: arsR Funciton: arsenical resistance operon repressor Locus tag: SE0135 Name: arsB Funciton: arsenic efflux pump protein Locus tag: SE0134 Name: arsC Funciton: arsenate reductase
	SE0138	arsD	arsenical resistance operon trans-acting ArsD
	SE0137	arsA	arsenite-transporting ATPase
	SE0136	arsR	arsenical resistance operon repressor
	SE0135	arsB	arsenic efflux pump protein
	SE0134	arsC	arsenate reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD