Regulon of ArsR in Staphylococcus capitis SK14

Properties
Regulator type:	Transcription factor
TF locus tag:	STACA0001_1318
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate; Arsenite
Regulog:	ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - ArsR
By effector - Arsenate
By effector - Arsenite
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 6 Sequence: TATATAGATATTTGTCTATATA Position: -42 Score: 6.8 Sequence: TATATAGATGATAATCTATAAT Locus tag: STACA0001_1318 Name: arsR Funciton: arsenical resistance operon repressor Locus tag: STACA0001_1319 Name: arsB Funciton: arsenical pump membrane protein Locus tag: STACA0001_1320 Name: arsC Funciton: arsenate reductase
	STACA0001_1318	arsR	arsenical resistance operon repressor
	STACA0001_1319	arsB	arsenical pump membrane protein
	STACA0001_1320	arsC	arsenate reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD