Regulon of ArsR in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type:	Transcription factor
TF locus tag:	SH0103, SH0110, SH0114
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate; Arsenite
Regulog:	ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - ArsR
By effector - Arsenate
By effector - Arsenite
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 6.8 Sequence: TATATAGATGATAATCTATAAT Locus tag: SH0103 Name: arsR Funciton: arsenical resistance operon repressor Locus tag: SH0102 Name: arsB Funciton: arsenical pump membrane protein Locus tag: SH0101 Name: arsC Funciton: arsenate reductase
	SH0103	arsR	arsenical resistance operon repressor
	SH0102	arsB	arsenical pump membrane protein
	SH0101	arsC	arsenate reductase
Position: -213 Score: 5.3 Sequence: AATATAAATCAATATCTATATT Position: -65 Score: 5.1 Sequence: AACATAGACACCAATCTATATA Position: -49 Score: 6.7 Sequence: TATATAGATGTTAATCTATAAT Locus tag: SH0112 Name: arsD Funciton: arsenical resistance operon trans-acting ArsD Locus tag: SH0111 Name: arsA Funciton: arsenite-transporting ATPase Locus tag: SH0110 Name: arsR Funciton: arsenical resistance operon repressor Locus tag: SH0109 Name: arsB Funciton: arsenic efflux pump protein Locus tag: SH0108 Name: arsC Funciton: arsenate reductase
	SH0112	arsD	arsenical resistance operon trans-acting ArsD
	SH0111	arsA	arsenite-transporting ATPase
	SH0110	arsR	arsenical resistance operon repressor
	SH0109	arsB	arsenic efflux pump protein
	SH0108	arsC	arsenate reductase
Position: -254 Score: 6.7 Sequence: ATTATAGATTAACATCTATATA Position: -238 Score: 5.1 Sequence: TATATAGATTGGTGTCTATGTT Position: -90 Score: 5.3 Sequence: AATATAGATATTGATTTATATT Locus tag: SH0113 Name: SH0113 Funciton: hypothetical protein Locus tag: SH0114 Name: arsR3 Funciton: hypothetical protein Locus tag: SH0115 Name: SE0140 Funciton: putative permease Locus tag: SH0116 Name: SE0141 Funciton: hypothetical protein
	SH0113	SH0113	hypothetical protein
	SH0114	arsR3	hypothetical protein
	SH0115	SE0140	putative permease
	SH0116	SE0141	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD