Regulon of ArsR in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_1484
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate; Arsenite
Regulog:	ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - ArsR
By effector - Arsenate
By effector - Arsenite
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 5.6 Sequence: TATATAGACACTTATCTATATA Position: -46 Score: 6.8 Sequence: TATATAGATGTTAATCTATGTA Locus tag: MCCL_1484 Name: arsR Funciton: arsenical resistance operon repressor Locus tag: MCCL_1485 Name: arsB Funciton: arsenic efflux pump protein Locus tag: MCCL_1486 Name: arsC Funciton: arsenate reductase
	MCCL_1484	arsR	arsenical resistance operon repressor
	MCCL_1485	arsB	arsenic efflux pump protein
	MCCL_1486	arsC	arsenate reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD