Regulog EutR - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Statistics of regulated genes
Genome	Genes	Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1
Loktanella vestfoldensis SKA53	8	2
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597	9	2
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222	8	2
Rhodobacter sphaeroides 2.4.1	8	2
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193	8	2
Roseovarius nubinhibens ISM	8	2
Roseovarius sp. 217	8	2
Silicibacter TM1040	8	2
Silicibacter pomeroyi DSS-3	8	2
Sulfitobacter sp. EE-36	8	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
eutA	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	* Loktanella vestfoldensis SKA53 Site: position = -101 score = 4.96778 sequence = GTTGAAACGTTTGTTTCAAA Gene: SKA53_10329: COG3931: Predicted N-formylglutamate amidohydrolase	Oceanicaulis alexandrii HTCC2633	* Oceanicola batsensis HTCC2597 Site: position = -53 score = 5.26582 sequence = TTTGTAGAAATTGTTACAGG Gene: OB2597_09009: COG3931: Predicted N-formylglutamate amidohydrolase	Oceanicola granulosus HTCC2516	* Paracoccus denitrificans PD1222 Site: position = -93 score = 4.08191 sequence = TTCGTAACATTCTTAACAGG Site: position = -63 score = 5.0671 sequence = TCTGAAAAATAATTGACAGA Gene: Pden_4543: COG3931: Predicted N-formylglutamate amidohydrolase	* Rhodobacter sphaeroides 2.4.1 Site: position = -87 score = 4.32351 sequence = GAAGAAAAATTCTTGACAGA Site: position = -116 score = 4.62553 sequence = GCAGTAAACATCTTAACAGC Gene: RSP_2323: COG3931: Predicted N-formylglutamate amidohydrolase	Rhodobacterales bacterium HTCC2654	* Roseobacter sp. MED193 Site: position = -64 score = 5.06191 sequence = TCTGAAATTATATTGACAGA Site: position = -34 score = 5.11337 sequence = CGTGAAAAGATTTTTCCAAA Gene: MED193_10026: COG3931: Predicted N-formylglutamate amidohydrolase	* Roseovarius nubinhibens ISM Site: position = -62 score = 5.75781 sequence = TGTGAAAACATTTTTTCAAA Gene: ISM_11445: COG3931: Predicted N-formylglutamate amidohydrolase	* Roseovarius sp. 217 Site: position = -36 score = 5.6105 sequence = TGTGGAAACATTTTTACAAA Site: position = -66 score = 4.82484 sequence = GCTGGAAATATATTGACACA Gene: ROS217_08284: COG3931: Predicted N-formylglutamate amidohydrolase	* Silicibacter TM1040 Site: position = -54 score = 5.19503 sequence = GATGAAAGAATTTTTACAGA Gene: TM1040_2787: COG3931: Predicted N-formylglutamate amidohydrolase	* Silicibacter pomeroyi DSS-3 Site: position = -10 score = 5.1223 sequence = GTTGTAACCAATGTTACACA Site: position = -54 score = 5.33844 sequence = TCTGTAATCATGTCTACAGA Gene: SPO2603: COG3931: Predicted N-formylglutamate amidohydrolase	* Sulfitobacter sp. EE-36 Site: position = -83 score = 4.7874 sequence = TGTGAAGCAAAGATTACAGA Gene: EE36_04403: COG3931: Predicted N-formylglutamate amidohydrolase	COG3931: Predicted N-formylglutamate amidohydrolase
eutQ	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53 Gene: SKA53_10324: TRAP-type ethanolamine transport system, small permease component	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597 Gene: OB2597_09004: TRAP-type ethanolamine transport system, small permease component	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4544: TRAP-type ethanolamine transport system, small permease component	Rhodobacter sphaeroides 2.4.1 Gene: RSP_2322: TRAP-type ethanolamine transport system, small permease component	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193 Gene: MED193_10031: TRAP-type ethanolamine transport system, small permease component	Roseovarius nubinhibens ISM Gene: ISM_11440: TRAP-type ethanolamine transport system, small permease component	Roseovarius sp. 217 Gene: ROS217_08289: TRAP-type ethanolamine transport system, small permease component	Silicibacter TM1040 Gene: TM1040_2786: TRAP-type ethanolamine transport system, small permease component	Silicibacter pomeroyi DSS-3 Gene: SPO2604: TRAP-type ethanolamine transport system, small permease component	Sulfitobacter sp. EE-36 Gene: EE36_04398: TRAP-type ethanolamine transport system, small permease component	TRAP-type ethanolamine transport system, small permease component
eutM	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53 Gene: SKA53_10319: TRAP-type ethanolamine transport system, large permease component	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597 Gene: OB2597_08999: TRAP-type ethanolamine transport system, large permease component	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4545: TRAP-type ethanolamine transport system, large permease component	Rhodobacter sphaeroides 2.4.1 Gene: RSP_2321: TRAP-type ethanolamine transport system, large permease component	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193 Gene: MED193_10036: TRAP-type ethanolamine transport system, large permease component	Roseovarius nubinhibens ISM Gene: ISM_11435: TRAP-type ethanolamine transport system, large permease component	Roseovarius sp. 217 Gene: ROS217_08294: TRAP-type ethanolamine transport system, large permease component	Silicibacter TM1040 Gene: TM1040_2785: TRAP-type ethanolamine transport system, large permease component	Silicibacter pomeroyi DSS-3 Gene: SPO2605: TRAP-type ethanolamine transport system, large permease component	Sulfitobacter sp. EE-36 Gene: EE36_04393: TRAP-type ethanolamine transport system, large permease component	TRAP-type ethanolamine transport system, large permease component
eutP	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53 Gene: SKA53_10314: TRAP-type ethanolamine transport system, periplasmic component	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597 Gene: OB2597_08994: TRAP-type ethanolamine transport system, periplasmic component	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4546: TRAP-type ethanolamine transport system, periplasmic component	Rhodobacter sphaeroides 2.4.1 Gene: RSP_2320: TRAP-type ethanolamine transport system, periplasmic component	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193 Gene: MED193_10041: TRAP-type ethanolamine transport system, periplasmic component	Roseovarius nubinhibens ISM Gene: ISM_11430: TRAP-type ethanolamine transport system, periplasmic component	Roseovarius sp. 217 Gene: ROS217_08299: TRAP-type ethanolamine transport system, periplasmic component	Silicibacter TM1040 Gene: TM1040_2784: TRAP-type ethanolamine transport system, periplasmic component	Silicibacter pomeroyi DSS-3 Gene: SPO2606: TRAP-type ethanolamine transport system, periplasmic component	Sulfitobacter sp. EE-36 Gene: EE36_04388: TRAP-type ethanolamine transport system, periplasmic component	TRAP-type ethanolamine transport system, periplasmic component
eutB	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53 Gene: SKA53_10309: glutamine synthetase family protein	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597 Gene: OB2597_08989: glutamine synthetase family protein	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4547: glutamine synthetase family protein	Rhodobacter sphaeroides 2.4.1 Gene: RSP_2319: glutamine synthetase family protein	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193 Gene: MED193_10046: glutamine synthetase family protein	Roseovarius nubinhibens ISM Gene: ISM_11425: glutamine synthetase family protein	Roseovarius sp. 217 Gene: ROS217_08304: glutamine synthetase family protein	Silicibacter TM1040 Gene: TM1040_2783: glutamine synthetase family protein	Silicibacter pomeroyi DSS-3 Gene: SPO2607: glutamine synthetase family protein	Sulfitobacter sp. EE-36 Gene: EE36_04383: glutamine synthetase family protein	glutamine synthetase family protein
OB2597_08984	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597 Gene: OB2597_08984: BIPHENYL-2,3-DIOL 1,2-DIOXYGENASE III (EC 1.13.11.39)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	BIPHENYL-2,3-DIOL 1,2-DIOXYGENASE III (EC 1.13.11.39)
eutX	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53 Gene: SKA53_10304: Aldehyde dehydrogenase (EC 1.2.1.3)	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597 Gene: OB2597_08979: Aldehyde dehydrogenase (EC 1.2.1.3)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4548: Aldehyde dehydrogenase (EC 1.2.1.3)	Rhodobacter sphaeroides 2.4.1 Gene: RSP_2318: Aldehyde dehydrogenase (EC 1.2.1.3)	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193 Gene: MED193_10051: Aldehyde dehydrogenase (EC 1.2.1.3)	Roseovarius nubinhibens ISM Gene: ISM_11420: Aldehyde dehydrogenase (EC 1.2.1.3)	Roseovarius sp. 217 Gene: ROS217_08309: Aldehyde dehydrogenase (EC 1.2.1.3)	Silicibacter TM1040 Gene: TM1040_2782: Aldehyde dehydrogenase (EC 1.2.1.3)	Silicibacter pomeroyi DSS-3 Gene: SPO2608: Aldehyde dehydrogenase (EC 1.2.1.3)	Sulfitobacter sp. EE-36 Gene: EE36_04378: Aldehyde dehydrogenase (EC 1.2.1.3)	Aldehyde dehydrogenase (EC 1.2.1.3)
eutY	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53 Gene: SKA53_10299: Alcohol dehydrogenase (EC 1.1.1.1)	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597 Gene: OB2597_08974: Alcohol dehydrogenase (EC 1.1.1.1)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4549: Alcohol dehydrogenase (EC 1.1.1.1)	Rhodobacter sphaeroides 2.4.1 Gene: RSP_2317: Alcohol dehydrogenase (EC 1.1.1.1)	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193 Gene: MED193_10056: Alcohol dehydrogenase (EC 1.1.1.1)	Roseovarius nubinhibens ISM Gene: ISM_11415: Alcohol dehydrogenase (EC 1.1.1.1)	Roseovarius sp. 217 Gene: ROS217_08314: Alcohol dehydrogenase (EC 1.1.1.1)	Silicibacter TM1040 Gene: TM1040_2781: Alcohol dehydrogenase (EC 1.1.1.1)	Silicibacter pomeroyi DSS-3 Gene: SPO2609: Alcohol dehydrogenase (EC 1.1.1.1)	Sulfitobacter sp. EE-36 Gene: EE36_04373: Alcohol dehydrogenase (EC 1.1.1.1)	Alcohol dehydrogenase (EC 1.1.1.1)

CRON 2.
eutR	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	* Loktanella vestfoldensis SKA53 Site: position = -46 score = 4.96778 sequence = TTTGAAACAAACGTTTCAAC Gene: SKA53_10334: Transcriptional regulator of ethanolamine utilization, RpiR family	Oceanicaulis alexandrii HTCC2633	* Oceanicola batsensis HTCC2597 Site: position = -53 score = 5.26582 sequence = CCTGTAACAATTTCTACAAA Gene: OB2597_09014: Transcriptional regulator of ethanolamine utilization, RpiR family	Oceanicola granulosus HTCC2516	* Paracoccus denitrificans PD1222 Site: position = -48 score = 4.08191 sequence = CCTGTTAAGAATGTTACGAA Site: position = -78 score = 5.0671 sequence = TCTGTCAATTATTTTTCAGA Gene: Pden_4542: Transcriptional regulator of ethanolamine utilization, RpiR family	* Rhodobacter sphaeroides 2.4.1 Site: position = -107 score = 4.32351 sequence = TCTGTCAAGAATTTTTCTTC Site: position = -78 score = 4.62553 sequence = GCTGTTAAGATGTTTACTGC Gene: RSP_2324: Transcriptional regulator of ethanolamine utilization, RpiR family	Rhodobacterales bacterium HTCC2654	* Roseobacter sp. MED193 Site: position = -143 score = 5.11337 sequence = TTTGGAAAAATCTTTTCACG Site: position = -113 score = 5.06191 sequence = TCTGTCAATATAATTTCAGA Gene: MED193_10021: Transcriptional regulator of ethanolamine utilization, RpiR family	* Roseovarius nubinhibens ISM Site: position = -109 score = 5.75781 sequence = TTTGAAAAAATGTTTTCACA Gene: ISM_11450: Transcriptional regulator of ethanolamine utilization, RpiR family	* Roseovarius sp. 217 Site: position = 11 score = 4.82484 sequence = TGTGTCAATATATTTCCAGC Site: position = -19 score = 5.6105 sequence = TTTGTAAAAATGTTTCCACA Gene: ROS217_08279: Transcriptional regulator of ethanolamine utilization, RpiR family	* Silicibacter TM1040 Site: position = -70 score = 5.19503 sequence = TCTGTAAAAATTCTTTCATC Gene: TM1040_2788: Transcriptional regulator of ethanolamine utilization, RpiR family	* Silicibacter pomeroyi DSS-3 Site: position = -105 score = 5.1223 sequence = TGTGTAACATTGGTTACAAC Site: position = -61 score = 5.33844 sequence = TCTGTAGACATGATTACAGA Gene: SPO2602: Transcriptional regulator of ethanolamine utilization, RpiR family	* Sulfitobacter sp. EE-36 Site: position = -51 score = 4.7874 sequence = TCTGTAATCTTTGCTTCACA Gene: EE36_04408: Transcriptional regulator of ethanolamine utilization, RpiR family	Transcriptional regulator of ethanolamine utilization, RpiR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog EutR - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --