Regulon of EutR in Roseovarius nubinhibens ISM

Properties
Regulator type:	Transcription factor
TF locus tag:	ISM_11450
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 5.8 Sequence: TGTGAAAACATTTTTTCAAA Locus tag: ISM_11445 Name: eutA Funciton: COG3931: Predicted N-formylglutamate amidohydrolase Locus tag: ISM_11440 Name: eutQ Funciton: TRAP-type ethanolamine transport system, small permease component Locus tag: ISM_11435 Name: eutM Funciton: TRAP-type ethanolamine transport system, large permease component Locus tag: ISM_11430 Name: eutP Funciton: TRAP-type ethanolamine transport system, periplasmic component Locus tag: ISM_11425 Name: eutB Funciton: glutamine synthetase family protein Locus tag: ISM_11420 Name: eutX Funciton: Aldehyde dehydrogenase (EC 1.2.1.3) Locus tag: ISM_11415 Name: eutY Funciton: Alcohol dehydrogenase (EC 1.1.1.1)
	ISM_11445	eutA	COG3931: Predicted N-formylglutamate amidohydrolase
	ISM_11440	eutQ	TRAP-type ethanolamine transport system, small permease component
	ISM_11435	eutM	TRAP-type ethanolamine transport system, large permease component
	ISM_11430	eutP	TRAP-type ethanolamine transport system, periplasmic component
	ISM_11425	eutB	glutamine synthetase family protein
	ISM_11420	eutX	Aldehyde dehydrogenase (EC 1.2.1.3)
	ISM_11415	eutY	Alcohol dehydrogenase (EC 1.1.1.1)
Position: -109 Score: 5.8 Sequence: TTTGAAAAAATGTTTTCACA Locus tag: ISM_11450 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	ISM_11450	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD