Regulon of EutR in Silicibacter pomeroyi DSS-3

Properties
Regulator type:	Transcription factor
TF locus tag:	SPO2602
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 5.3 Sequence: TCTGTAATCATGTCTACAGA Position: -10 Score: 5.1 Sequence: GTTGTAACCAATGTTACACA Locus tag: SPO2603 Name: eutA Funciton: COG3931: Predicted N-formylglutamate amidohydrolase Locus tag: SPO2604 Name: eutQ Funciton: TRAP-type ethanolamine transport system, small permease component Locus tag: SPO2605 Name: eutM Funciton: TRAP-type ethanolamine transport system, large permease component Locus tag: SPO2606 Name: eutP Funciton: TRAP-type ethanolamine transport system, periplasmic component Locus tag: SPO2607 Name: eutB Funciton: glutamine synthetase family protein Locus tag: SPO2608 Name: eutX Funciton: Aldehyde dehydrogenase (EC 1.2.1.3) Locus tag: SPO2609 Name: eutY Funciton: Alcohol dehydrogenase (EC 1.1.1.1)
	SPO2603	eutA	COG3931: Predicted N-formylglutamate amidohydrolase
	SPO2604	eutQ	TRAP-type ethanolamine transport system, small permease component
	SPO2605	eutM	TRAP-type ethanolamine transport system, large permease component
	SPO2606	eutP	TRAP-type ethanolamine transport system, periplasmic component
	SPO2607	eutB	glutamine synthetase family protein
	SPO2608	eutX	Aldehyde dehydrogenase (EC 1.2.1.3)
	SPO2609	eutY	Alcohol dehydrogenase (EC 1.1.1.1)
Position: -105 Score: 5.1 Sequence: TGTGTAACATTGGTTACAAC Position: -61 Score: 5.3 Sequence: TCTGTAGACATGATTACAGA Locus tag: SPO2602 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	SPO2602	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD