Regulon of EutR in Roseobacter sp. MED193

Properties
Regulator type:	Transcription factor
TF locus tag:	MED193_10021
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.1 Sequence: TCTGAAATTATATTGACAGA Position: -34 Score: 5.1 Sequence: CGTGAAAAGATTTTTCCAAA Locus tag: MED193_10026 Name: eutA Funciton: COG3931: Predicted N-formylglutamate amidohydrolase Locus tag: MED193_10031 Name: eutQ Funciton: TRAP-type ethanolamine transport system, small permease component Locus tag: MED193_10036 Name: eutM Funciton: TRAP-type ethanolamine transport system, large permease component Locus tag: MED193_10041 Name: eutP Funciton: TRAP-type ethanolamine transport system, periplasmic component Locus tag: MED193_10046 Name: eutB Funciton: glutamine synthetase family protein Locus tag: MED193_10051 Name: eutX Funciton: Aldehyde dehydrogenase (EC 1.2.1.3) Locus tag: MED193_10056 Name: eutY Funciton: Alcohol dehydrogenase (EC 1.1.1.1)
	MED193_10026	eutA	COG3931: Predicted N-formylglutamate amidohydrolase
	MED193_10031	eutQ	TRAP-type ethanolamine transport system, small permease component
	MED193_10036	eutM	TRAP-type ethanolamine transport system, large permease component
	MED193_10041	eutP	TRAP-type ethanolamine transport system, periplasmic component
	MED193_10046	eutB	glutamine synthetase family protein
	MED193_10051	eutX	Aldehyde dehydrogenase (EC 1.2.1.3)
	MED193_10056	eutY	Alcohol dehydrogenase (EC 1.1.1.1)
Position: -143 Score: 5.1 Sequence: TTTGGAAAAATCTTTTCACG Position: -113 Score: 5.1 Sequence: TCTGTCAATATAATTTCAGA Locus tag: MED193_10021 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	MED193_10021	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD