Regulon of EutR in Oceanicola batsensis HTCC2597

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Rhodobacterales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 5.3 Sequence: TTTGTAGAAATTGTTACAGG Locus tag: OB2597_09009 Name: eutA Funciton: COG3931: Predicted N-formylglutamate amidohydrolase Locus tag: OB2597_09004 Name: eutQ Funciton: TRAP-type ethanolamine transport system, small permease component Locus tag: OB2597_08999 Name: eutM Funciton: TRAP-type ethanolamine transport system, large permease component Locus tag: OB2597_08994 Name: eutP Funciton: TRAP-type ethanolamine transport system, periplasmic component Locus tag: OB2597_08989 Name: eutB Funciton: glutamine synthetase family protein Locus tag: OB2597_08984 Name: null Funciton: BIPHENYL-2,3-DIOL 1,2-DIOXYGENASE III (EC 1.13.11.39) Locus tag: OB2597_08979 Name: eutX Funciton: Aldehyde dehydrogenase (EC 1.2.1.3) Locus tag: OB2597_08974 Name: eutY Funciton: Alcohol dehydrogenase (EC 1.1.1.1)
	OB2597_09009	eutA	COG3931: Predicted N-formylglutamate amidohydrolase
	OB2597_09004	eutQ	TRAP-type ethanolamine transport system, small permease component
	OB2597_08999	eutM	TRAP-type ethanolamine transport system, large permease component
	OB2597_08994	eutP	TRAP-type ethanolamine transport system, periplasmic component
	OB2597_08989	eutB	glutamine synthetase family protein
	OB2597_08984		BIPHENYL-2,3-DIOL 1,2-DIOXYGENASE III (EC 1.13.11.39)
	OB2597_08979	eutX	Aldehyde dehydrogenase (EC 1.2.1.3)
	OB2597_08974	eutY	Alcohol dehydrogenase (EC 1.1.1.1)
Position: -53 Score: 5.3 Sequence: CCTGTAACAATTTCTACAAA Locus tag: OB2597_09014 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	OB2597_09014	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD