Regulon of EutR in Silicibacter TM1040

Properties
Regulator type:	Transcription factor
TF locus tag:	TM1040_2788
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 5.2 Sequence: GATGAAAGAATTTTTACAGA Locus tag: TM1040_2787 Name: eutA Funciton: COG3931: Predicted N-formylglutamate amidohydrolase Locus tag: TM1040_2786 Name: eutQ Funciton: TRAP-type ethanolamine transport system, small permease component Locus tag: TM1040_2785 Name: eutM Funciton: TRAP-type ethanolamine transport system, large permease component Locus tag: TM1040_2784 Name: eutP Funciton: TRAP-type ethanolamine transport system, periplasmic component Locus tag: TM1040_2783 Name: eutB Funciton: glutamine synthetase family protein Locus tag: TM1040_2782 Name: eutX Funciton: Aldehyde dehydrogenase (EC 1.2.1.3) Locus tag: TM1040_2781 Name: eutY Funciton: Alcohol dehydrogenase (EC 1.1.1.1)
	TM1040_2787	eutA	COG3931: Predicted N-formylglutamate amidohydrolase
	TM1040_2786	eutQ	TRAP-type ethanolamine transport system, small permease component
	TM1040_2785	eutM	TRAP-type ethanolamine transport system, large permease component
	TM1040_2784	eutP	TRAP-type ethanolamine transport system, periplasmic component
	TM1040_2783	eutB	glutamine synthetase family protein
	TM1040_2782	eutX	Aldehyde dehydrogenase (EC 1.2.1.3)
	TM1040_2781	eutY	Alcohol dehydrogenase (EC 1.1.1.1)
Position: -70 Score: 5.2 Sequence: TCTGTAAAAATTCTTTCATC Locus tag: TM1040_2788 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	TM1040_2788	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD