Regulon of EutR in Sulfitobacter sp. EE-36

Properties
Regulator type:	Transcription factor
TF locus tag:	EE36_04408
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 4.8 Sequence: TGTGAAGCAAAGATTACAGA Locus tag: EE36_04403 Name: eutA Funciton: COG3931: Predicted N-formylglutamate amidohydrolase Locus tag: EE36_04398 Name: eutQ Funciton: TRAP-type ethanolamine transport system, small permease component Locus tag: EE36_04393 Name: eutM Funciton: TRAP-type ethanolamine transport system, large permease component Locus tag: EE36_04388 Name: eutP Funciton: TRAP-type ethanolamine transport system, periplasmic component Locus tag: EE36_04383 Name: eutB Funciton: glutamine synthetase family protein Locus tag: EE36_04378 Name: eutX Funciton: Aldehyde dehydrogenase (EC 1.2.1.3) Locus tag: EE36_04373 Name: eutY Funciton: Alcohol dehydrogenase (EC 1.1.1.1)
	EE36_04403	eutA	COG3931: Predicted N-formylglutamate amidohydrolase
	EE36_04398	eutQ	TRAP-type ethanolamine transport system, small permease component
	EE36_04393	eutM	TRAP-type ethanolamine transport system, large permease component
	EE36_04388	eutP	TRAP-type ethanolamine transport system, periplasmic component
	EE36_04383	eutB	glutamine synthetase family protein
	EE36_04378	eutX	Aldehyde dehydrogenase (EC 1.2.1.3)
	EE36_04373	eutY	Alcohol dehydrogenase (EC 1.1.1.1)
Position: -51 Score: 4.8 Sequence: TCTGTAATCTTTGCTTCACA Locus tag: EE36_04408 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	EE36_04408	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD