Regulog FnrN - Sphingomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Statistics of regulated genes
Genome	Genes	Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1	12	5
Novosphingobium aromaticivorans DSM 12444	12	5
Sphingobium japonicum UT26S	10	3
Sphingomonas wittichii RW1	7	1
Sphingopyxis alaskensis RB2256	11	4
Zymomonas mobilis subsp. mobilis ZM4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
ccoN	Erythrobacter litoralis HTCC2594	* Erythrobacter sp. NAP1 Site: position = -72 score = 4.55505 sequence = AACTTGATCTGAGTCAAACA Gene: NAP1_15803: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Novosphingobium aromaticivorans DSM 12444 Site: position = -144 score = 4.63311 sequence = ACATTGACGGAGCGCAAAAA Site: position = -77 score = 4.9263 sequence = TATTTGACAAGGGTCAATGT Gene: Saro_2578: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Sphingobium japonicum UT26S Site: position = -74 score = 5.54064 sequence = GCTTTGACAGAGGTCAATGC Gene: SJA_C2-00670: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Sphingomonas wittichii RW1 Site: position = -200 score = 5.13916 sequence = GATTTGATCTGGCGCAAGGC Gene: Swit_1801: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Sphingopyxis alaskensis RB2256 Site: position = -112 score = 4.61486 sequence = GCATTGATGGAGCGCAAGCA Site: position = -90 score = 5.28227 sequence = TCGTTGATCCCGGTCAATGT Gene: Sala_1676: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	Zymomonas mobilis subsp. mobilis ZM4	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1 Gene: NAP1_15808: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_2577: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Sphingobium japonicum UT26S Gene: SJA_C2-00680: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Sphingomonas wittichii RW1 Gene: Swit_1800: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Sphingopyxis alaskensis RB2256 Gene: Sala_1675: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Zymomonas mobilis subsp. mobilis ZM4	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1 Gene: NAP1_15813: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_2576: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Sphingobium japonicum UT26S Gene: SJA_C2-00690: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Sphingomonas wittichii RW1 Gene: Swit_1799: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Sphingopyxis alaskensis RB2256 Gene: Sala_1674: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Zymomonas mobilis subsp. mobilis ZM4	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1 Gene: NAP1_15818: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_2575: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Sphingobium japonicum UT26S Gene: SJA_C2-00700: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Sphingomonas wittichii RW1 Gene: Swit_1798: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Sphingopyxis alaskensis RB2256 Gene: Sala_1673: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Zymomonas mobilis subsp. mobilis ZM4	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1 Gene: NAP1_15823: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_2574: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Sphingobium japonicum UT26S Gene: SJA_C2-00710: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Sphingomonas wittichii RW1	Sphingopyxis alaskensis RB2256 Gene: Sala_1672: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Zymomonas mobilis subsp. mobilis ZM4	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1 Gene: NAP1_15828: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_2573: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Sphingobium japonicum UT26S Gene: SJA_C2-00720: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Sphingomonas wittichii RW1	Sphingopyxis alaskensis RB2256 Gene: Sala_1671: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Zymomonas mobilis subsp. mobilis ZM4	Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1 Gene: NAP1_15833: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_2572: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Sphingobium japonicum UT26S Gene: SJA_C2-00730: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Sphingomonas wittichii RW1 Gene: Swit_1796: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Sphingopyxis alaskensis RB2256 Gene: Sala_1670: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Zymomonas mobilis subsp. mobilis ZM4	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1 Gene: NAP1_15838: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_2571: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Sphingobium japonicum UT26S Gene: SJA_C2-00740: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Sphingomonas wittichii RW1 Gene: Swit_1795: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Sphingopyxis alaskensis RB2256 Gene: Sala_1669: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Zymomonas mobilis subsp. mobilis ZM4	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoX	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1 Gene: Swit_1797: Predicted integral membrane protein CcoX	Sphingopyxis alaskensis RB2256	Zymomonas mobilis subsp. mobilis ZM4	Predicted integral membrane protein CcoX

CRON 2.
hemN	Erythrobacter litoralis HTCC2594	* Erythrobacter sp. NAP1 Site: position = -52 score = 5.26251 sequence = GATTTGATCTGGCGCAAAGA Gene: NAP1_15848: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	* Novosphingobium aromaticivorans DSM 12444 Site: position = -68 score = 4.87096 sequence = AATTTGCCATATCTCAATGC Gene: Saro_2569: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	Sphingobium japonicum UT26S Gene: SJA_C2-00620: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	Sphingomonas wittichii RW1	* Sphingopyxis alaskensis RB2256 Site: position = -51 score = 4.80294 sequence = CCGTTGATGCCGATCAATGC Gene: Sala_1668: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	Zymomonas mobilis subsp. mobilis ZM4	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)

CRON 3.
uspA	Erythrobacter litoralis HTCC2594	* Erythrobacter sp. NAP1 Site: position = -70 score = 5.45064 sequence = AAATTGATCTGGATCAATGC Gene: NAP1_01820: Predicted universal stress protein UspA	* Novosphingobium aromaticivorans DSM 12444 Site: position = -71 score = 4.29768 sequence = AATTTGACGTGGATCATGGT Gene: Saro_0571: Predicted universal stress protein UspA	Sphingobium japonicum UT26S Gene: SJA_C2-00480: Predicted universal stress protein UspA	Sphingomonas wittichii RW1 Gene: Swit_0266: Predicted universal stress protein UspA	* Sphingopyxis alaskensis RB2256 Site: position = -69 score = 4.78115 sequence = GATTTGATGCGAATCAATGA Gene: Sala_1679: Predicted universal stress protein UspA	Zymomonas mobilis subsp. mobilis ZM4	Predicted universal stress protein UspA

CRON 4.
fnrN	Erythrobacter litoralis HTCC2594 Gene: ELI_02800: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	* Erythrobacter sp. NAP1 Site: position = -3 score = 5.72965 sequence = GCATTGATCCAGGTCAATGC Gene: NAP1_15798: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	* Novosphingobium aromaticivorans DSM 12444 Site: position = -232 score = 4.64859 sequence = GTTTTGACATCCGTCAACGC Gene: Saro_2581: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	* Sphingobium japonicum UT26S Site: position = 10 score = 4.55827 sequence = GATTTGATCTGGCGCAAAAG Gene: SJA_C2-00660: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	Sphingomonas wittichii RW1 Gene: Swit_1945: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	Sphingopyxis alaskensis RB2256 Gene: Sala_1678: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	Zymomonas mobilis subsp. mobilis ZM4	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family

CRON 5.
ompW	Erythrobacter litoralis HTCC2594	* Erythrobacter sp. NAP1 Site: position = -238 score = 5.72965 sequence = GCATTGACCTGGATCAATGC Gene: NAP1_15793: Outer membrane protein W precursor	* Novosphingobium aromaticivorans DSM 12444 Site: position = -179 score = 4.9263 sequence = ACATTGACCCTTGTCAAATA Site: position = -112 score = 4.63311 sequence = TTTTTGCGCTCCGTCAATGT Gene: Saro_2579: Outer membrane protein W precursor	* Sphingobium japonicum UT26S Site: position = -103 score = 5.35119 sequence = ACATTGAGCCAGGTCAAATT Site: position = -81 score = 4.46499 sequence = CGGTTGCGCGGGATCAATGC Gene: SJA_C2-00650: Outer membrane protein W precursor	Sphingomonas wittichii RW1	* Sphingopyxis alaskensis RB2256 Site: position = -97 score = 5.28227 sequence = ACATTGACCGGGATCAACGA Site: position = -75 score = 4.61486 sequence = TGCTTGCGCTCCATCAATGC Gene: Sala_1677: Outer membrane protein W precursor	Zymomonas mobilis subsp. mobilis ZM4	Outer membrane protein W precursor

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog FnrN - Sphingomonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --