Regulog FnrN - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By trascription factor - FnrN/FixK
- By TF family - CRP
- By effector - Oxygen
- By pathway - Oxidative stress response
- By pathway - Nitrogen fixation
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | ||
| Erythrobacter sp. NAP1 | 12 | 5 |
| Novosphingobium aromaticivorans DSM 12444 | 12 | 5 |
| Sphingobium japonicum UT26S | 10 | 3 |
| Sphingomonas wittichii RW1 | 7 | 1 |
| Sphingopyxis alaskensis RB2256 | 11 | 4 |
| Zymomonas mobilis subsp. mobilis ZM4 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| ccoN |
|
*
Erythrobacter sp. NAP1 Site: position = -72 score = 4.55505 sequence = AACTTGATCTGAGTCAAACA Gene: NAP1_15803: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -144 score = 4.63311 sequence = ACATTGACGGAGCGCAAAAA Site: position = -77 score = 4.9263 sequence = TATTTGACAAGGGTCAATGT Gene: Saro_2578: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
*
Sphingobium japonicum UT26S Site: position = -74 score = 5.54064 sequence = GCTTTGACAGAGGTCAATGC Gene: SJA_C2-00670: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
*
Sphingomonas wittichii RW1 Site: position = -200 score = 5.13916 sequence = GATTTGATCTGGCGCAAGGC Gene: Swit_1801: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
*
Sphingopyxis alaskensis RB2256 Site: position = -112 score = 4.61486 sequence = GCATTGATGGAGCGCAAGCA Site: position = -90 score = 5.28227 sequence = TCGTTGATCCCGGTCAATGT Gene: Sala_1676: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
|
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
| ccoO |
|
Gene: NAP1_15808: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: Saro_2577: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: SJA_C2-00680: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: Swit_1800: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: Sala_1675: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
|
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
| ccoQ |
|
Gene: NAP1_15813: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
Gene: Saro_2576: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
Gene: SJA_C2-00690: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
Gene: Swit_1799: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
Gene: Sala_1674: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
|
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
| ccoP |
|
Gene: NAP1_15818: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: Saro_2575: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: SJA_C2-00700: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: Swit_1798: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: Sala_1673: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
|
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
| ccoG |
|
Gene: NAP1_15823: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
Gene: Saro_2574: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
Gene: SJA_C2-00710: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
|
Gene: Sala_1672: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
|
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
| ccoH |
|
Gene: NAP1_15828: Type cbb3 cytochrome oxidase biogenesis protein CcoH |
Gene: Saro_2573: Type cbb3 cytochrome oxidase biogenesis protein CcoH |
Gene: SJA_C2-00720: Type cbb3 cytochrome oxidase biogenesis protein CcoH |
|
Gene: Sala_1671: Type cbb3 cytochrome oxidase biogenesis protein CcoH |
|
Type cbb3 cytochrome oxidase biogenesis protein CcoH |
| ccoI |
|
Gene: NAP1_15833: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Saro_2572: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: SJA_C2-00730: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Swit_1796: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Sala_1670: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
| ccoS |
|
Gene: NAP1_15838: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
Gene: Saro_2571: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
Gene: SJA_C2-00740: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
Gene: Swit_1795: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
Gene: Sala_1669: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
|
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
| ccoX |
|
|
|
|
Gene: Swit_1797: Predicted integral membrane protein CcoX |
|
|
Predicted integral membrane protein CcoX |
| CRON 2. | ||||||||
| hemN |
|
*
Erythrobacter sp. NAP1 Site: position = -52 score = 5.26251 sequence = GATTTGATCTGGCGCAAAGA Gene: NAP1_15848: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -68 score = 4.87096 sequence = AATTTGCCATATCTCAATGC Gene: Saro_2569: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
Gene: SJA_C2-00620: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
|
*
Sphingopyxis alaskensis RB2256 Site: position = -51 score = 4.80294 sequence = CCGTTGATGCCGATCAATGC Gene: Sala_1668: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
|
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
| CRON 3. | ||||||||
| uspA |
|
*
Erythrobacter sp. NAP1 Site: position = -70 score = 5.45064 sequence = AAATTGATCTGGATCAATGC Gene: NAP1_01820: Predicted universal stress protein UspA |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -71 score = 4.29768 sequence = AATTTGACGTGGATCATGGT Gene: Saro_0571: Predicted universal stress protein UspA |
Gene: SJA_C2-00480: Predicted universal stress protein UspA |
Gene: Swit_0266: Predicted universal stress protein UspA |
*
Sphingopyxis alaskensis RB2256 Site: position = -69 score = 4.78115 sequence = GATTTGATGCGAATCAATGA Gene: Sala_1679: Predicted universal stress protein UspA |
|
Predicted universal stress protein UspA |
| CRON 4. | ||||||||
| fnrN |
Gene: ELI_02800: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
*
Erythrobacter sp. NAP1 Site: position = -3 score = 5.72965 sequence = GCATTGATCCAGGTCAATGC Gene: NAP1_15798: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -232 score = 4.64859 sequence = GTTTTGACATCCGTCAACGC Gene: Saro_2581: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
*
Sphingobium japonicum UT26S Site: position = 10 score = 4.55827 sequence = GATTTGATCTGGCGCAAAAG Gene: SJA_C2-00660: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
Gene: Swit_1945: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
Gene: Sala_1678: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
|
Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
| CRON 5. | ||||||||
| ompW |
|
*
Erythrobacter sp. NAP1 Site: position = -238 score = 5.72965 sequence = GCATTGACCTGGATCAATGC Gene: NAP1_15793: Outer membrane protein W precursor |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -179 score = 4.9263 sequence = ACATTGACCCTTGTCAAATA Site: position = -112 score = 4.63311 sequence = TTTTTGCGCTCCGTCAATGT Gene: Saro_2579: Outer membrane protein W precursor |
*
Sphingobium japonicum UT26S Site: position = -103 score = 5.35119 sequence = ACATTGAGCCAGGTCAAATT Site: position = -81 score = 4.46499 sequence = CGGTTGCGCGGGATCAATGC Gene: SJA_C2-00650: Outer membrane protein W precursor |
|
*
Sphingopyxis alaskensis RB2256 Site: position = -97 score = 5.28227 sequence = ACATTGACCGGGATCAACGA Site: position = -75 score = 4.61486 sequence = TGCTTGCGCTCCATCAATGC Gene: Sala_1677: Outer membrane protein W precursor |
|
Outer membrane protein W precursor |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |