Orthologous regulated operons containing ccoG gene

Properties
Regulog:	FnrN - Sphingomonadales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha

Built upon 23 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Erythrobacter sp. NAP1
Position: -72 Score: 4.55505 Sequence: AACTTGATCTGAGTCAAACA Locus tag: NAP1_15803 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: NAP1_15808 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: NAP1_15813 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: NAP1_15818 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: NAP1_15823 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: NAP1_15828 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: NAP1_15833 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: NAP1_15838 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS	-72	4.6	AACTTGATCTGAGTCAAACA	NAP1_15803
Novosphingobium aromaticivorans DSM 12444
Position: -144 Score: 4.63311 Sequence: ACATTGACGGAGCGCAAAAA Position: -77 Score: 4.9263 Sequence: TATTTGACAAGGGTCAATGT Locus tag: Saro_2578 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Saro_2577 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Saro_2576 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Saro_2575 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Saro_2574 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Saro_2573 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Saro_2572 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Saro_2571 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS	-144	4.6	ACATTGACGGAGCGCAAAAA	Saro_2578
	-77	4.9	TATTTGACAAGGGTCAATGT
Sphingobium japonicum UT26S
Position: -74 Score: 5.54064 Sequence: GCTTTGACAGAGGTCAATGC Locus tag: SJA_C2-00670 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: SJA_C2-00680 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: SJA_C2-00690 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: SJA_C2-00700 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: SJA_C2-00710 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: SJA_C2-00720 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: SJA_C2-00730 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: SJA_C2-00740 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS	-74	5.5	GCTTTGACAGAGGTCAATGC	SJA_C2-00670
Sphingopyxis alaskensis RB2256
Position: -112 Score: 4.61486 Sequence: GCATTGATGGAGCGCAAGCA Position: -90 Score: 5.28227 Sequence: TCGTTGATCCCGGTCAATGT Locus tag: Sala_1676 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Sala_1675 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Sala_1674 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Sala_1673 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Sala_1672 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Sala_1671 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Sala_1670 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Sala_1669 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS	-112	4.6	GCATTGATGGAGCGCAAGCA	Sala_1676
	-90	5.3	TCGTTGATCCCGGTCAATGT