Regulon of FnrN in Erythrobacter sp. NAP1

Properties
Regulator type:	Transcription factor
TF locus tag:	NAP1_15798
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Sphingomonadales
Statistics of regulated genes:
- Genes	12
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -238 Score: 5.7 Sequence: GCATTGACCTGGATCAATGC Locus tag: NAP1_15793 Name: ompW Funciton: Outer membrane protein W precursor
	NAP1_15793	ompW	Outer membrane protein W precursor
Position: -70 Score: 5.5 Sequence: AAATTGATCTGGATCAATGC Locus tag: NAP1_01820 Name: uspA Funciton: Predicted universal stress protein UspA
	NAP1_01820	uspA	Predicted universal stress protein UspA
Position: -3 Score: 5.7 Sequence: GCATTGATCCAGGTCAATGC Locus tag: NAP1_15798 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	NAP1_15798	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -52 Score: 5.3 Sequence: GATTTGATCTGGCGCAAAGA Locus tag: NAP1_15848 Name: hemN Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
	NAP1_15848	hemN	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
Position: -72 Score: 4.6 Sequence: AACTTGATCTGAGTCAAACA Locus tag: NAP1_15803 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: NAP1_15808 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: NAP1_15813 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: NAP1_15818 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: NAP1_15823 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: NAP1_15828 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: NAP1_15833 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: NAP1_15838 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	NAP1_15803	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	NAP1_15808	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	NAP1_15813	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	NAP1_15818	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	NAP1_15823	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	NAP1_15828	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	NAP1_15833	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	NAP1_15838	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD