Regulon of FnrN in Sphingobium japonicum UT26S

Properties
Regulator type:	Transcription factor
TF locus tag:	SJA_C2-00660
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Sphingomonadales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: 10 Score: 4.6 Sequence: GATTTGATCTGGCGCAAAAG Locus tag: SJA_C2-00660 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	SJA_C2-00660	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -103 Score: 5.4 Sequence: ACATTGAGCCAGGTCAAATT Position: -81 Score: 4.5 Sequence: CGGTTGCGCGGGATCAATGC Locus tag: SJA_C2-00650 Name: ompW Funciton: Outer membrane protein W precursor
	SJA_C2-00650	ompW	Outer membrane protein W precursor
Position: -74 Score: 5.5 Sequence: GCTTTGACAGAGGTCAATGC Locus tag: SJA_C2-00670 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: SJA_C2-00680 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: SJA_C2-00690 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: SJA_C2-00700 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: SJA_C2-00710 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: SJA_C2-00720 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: SJA_C2-00730 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: SJA_C2-00740 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	SJA_C2-00670	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	SJA_C2-00680	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	SJA_C2-00690	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	SJA_C2-00700	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	SJA_C2-00710	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	SJA_C2-00720	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	SJA_C2-00730	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	SJA_C2-00740	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD