Regulog PaaR - Frankineae/Propionibacterineae/Pseudonocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Phenylacetic acid degradation |
| Effector: | Phenylacetyl-CoA |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
- By trascription factor - PaaR
- By TF family - TetR
- By effector - Phenylacetyl-CoA
- By pathway - Phenylacetic acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Nocardioides sp. JS614 | ||
| Propionibacterium acnes KPA171202 | ||
| Frankia sp. CcI3 | ||
| Frankia sp. EAN1pec | ||
| Acidothermus cellulolyticus 11B | 7 | 2 |
| Nakamurella multipartita DSM 44233 | 10 | 2 |
| Actinosynnema mirum DSM 43827 | ||
| Saccharomonospora viridis DSM 43017 | 10 | 3 |
| Saccharopolyspora erythraea NRRL 2338 | 8 | 2 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| paaA |
Gene: Noca_3159: Phenylacetate-CoA oxygenase, PaaA subunit |
|
|
|
*
Acidothermus cellulolyticus 11B Site: position = -41 score = 5.70798 sequence = GTCAACCGAACATTCGGTCGGT Gene: Acel_1443: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Nakamurella multipartita DSM 44233 Site: position = -70 score = 5.64783 sequence = TCTTACTGACCGTTCGGTCAGT Site: position = -66 score = 4.98581 sequence = ACTGACCGTTCGGTCAGTTACA Gene: Namu_2491: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: Amir_6692: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: Svir_26530: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: SACE_3544: Phenylacetate-CoA oxygenase, PaaA subunit |
Phenylacetate-CoA oxygenase, PaaA subunit |
| paaB |
Gene: Noca_3158: Phenylacetate-CoA oxygenase, PaaB subunit |
|
|
|
Gene: Acel_1442: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Namu_2490: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Amir_6691: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Svir_26520: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: SACE_3545: Phenylacetate-CoA oxygenase, PaaB subunit |
Phenylacetate-CoA oxygenase, PaaB subunit |
| paaC |
Gene: Noca_3157: Phenylacetate-CoA oxygenase, PaaC subunit |
|
|
|
Gene: Acel_1441: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Namu_2489: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Amir_6690: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Svir_26510: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: SACE_3546: Phenylacetate-CoA oxygenase, PaaC subunit |
Phenylacetate-CoA oxygenase, PaaC subunit |
| paaD |
Gene: Noca_3156: Phenylacetate-CoA oxygenase, PaaD subunit |
|
|
|
Gene: Acel_1440: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Namu_2488: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Amir_6689: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Svir_26500: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: SACE_3547: Phenylacetate-CoA oxygenase, PaaD subunit |
Phenylacetate-CoA oxygenase, PaaD subunit |
| paaE |
Gene: Noca_3155: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
|
|
|
Gene: Acel_1439: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Namu_2487: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Amir_6688: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Svir_26490: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: SACE_3548: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
| Namu_2486 |
|
|
|
|
|
Gene: Namu_2486: hypothetical protein |
|
|
|
hypothetical protein |
| paaZ |
|
|
|
|
*
Acidothermus cellulolyticus 11B Site: position = -177 score = 5.33565 sequence = GCCGACCGAACGTTCGGTCTAG Gene: Acel_1435: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Gene: Namu_2485: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
*
Saccharomonospora viridis DSM 43017 Site: position = -39 score = 5.34266 sequence = ACTTCCTGAACGTTCGGTTGGT Gene: Svir_26540: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -186 score = 5.46792 sequence = ACTGACCGAGTAGTCGGTTATT Site: position = -52 score = 5.45253 sequence = CGTTACCGAACGAACGGTCGGT Site: position = -48 score = 5.4452 sequence = ACCGAACGAACGGTCGGTAAAA Gene: SACE_3543: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
| paaR |
|
|
|
|
Gene: Acel_1436: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Nakamurella multipartita DSM 44233 Site: position = -43 score = 5.95483 sequence = ACTGACCGAATGATCGGTCAGC Gene: Namu_2483: Transcriptional regulator of phenylacetic acid degradation, TetR family |
|
Gene: Svir_26580: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: SACE_3541: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Transcriptional regulator of phenylacetic acid degradation, TetR family |
| paaH |
|
|
|
|
Gene: Acel_0147: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: Namu_2482: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
*
Saccharomonospora viridis DSM 43017 Site: position = -116 score = 5.63002 sequence = ACTGACCGAATGGACGGTTACT Gene: Svir_26550: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
| paaI |
|
|
|
|
|
Gene: Namu_2481: Phenylacetic acid degradation protein PaaI, thioesterase |
|
*
Saccharomonospora viridis DSM 43017 Site: position = -42 score = 5.63002 sequence = AGTAACCGTCCATTCGGTCAGT Gene: Svir_26560: Phenylacetic acid degradation protein PaaI, thioesterase |
|
Phenylacetic acid degradation protein PaaI, thioesterase |
| paaK |
|
|
|
|
|
|
|
Gene: Svir_26570: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -232 score = 5.4452 sequence = TTTTACCGACCGTTCGTTCGGT Site: position = -228 score = 5.45253 sequence = ACCGACCGTTCGTTCGGTAACG Site: position = -94 score = 5.46792 sequence = AATAACCGACTACTCGGTCAGT Gene: SACE_3542: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |