Regulog PaaR - Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Statistics of regulated genes
Genome	Genes	Operons
Nocardioides sp. JS614
Propionibacterium acnes KPA171202
Frankia sp. CcI3
Frankia sp. EAN1pec
Acidothermus cellulolyticus 11B	7	2
Nakamurella multipartita DSM 44233	10	2
Actinosynnema mirum DSM 43827
Saccharomonospora viridis DSM 43017	10	3
Saccharopolyspora erythraea NRRL 2338	8	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
paaA	Nocardioides sp. JS614 Gene: Noca_3159: Phenylacetate-CoA oxygenase, PaaA subunit	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	* Acidothermus cellulolyticus 11B Site: position = -41 score = 5.70798 sequence = GTCAACCGAACATTCGGTCGGT Gene: Acel_1443: Phenylacetate-CoA oxygenase, PaaA subunit	* Nakamurella multipartita DSM 44233 Site: position = -70 score = 5.64783 sequence = TCTTACTGACCGTTCGGTCAGT Site: position = -66 score = 4.98581 sequence = ACTGACCGTTCGGTCAGTTACA Gene: Namu_2491: Phenylacetate-CoA oxygenase, PaaA subunit	Actinosynnema mirum DSM 43827 Gene: Amir_6692: Phenylacetate-CoA oxygenase, PaaA subunit	Saccharomonospora viridis DSM 43017 Gene: Svir_26530: Phenylacetate-CoA oxygenase, PaaA subunit	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_3544: Phenylacetate-CoA oxygenase, PaaA subunit	Phenylacetate-CoA oxygenase, PaaA subunit
paaB	Nocardioides sp. JS614 Gene: Noca_3158: Phenylacetate-CoA oxygenase, PaaB subunit	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	Acidothermus cellulolyticus 11B Gene: Acel_1442: Phenylacetate-CoA oxygenase, PaaB subunit	Nakamurella multipartita DSM 44233 Gene: Namu_2490: Phenylacetate-CoA oxygenase, PaaB subunit	Actinosynnema mirum DSM 43827 Gene: Amir_6691: Phenylacetate-CoA oxygenase, PaaB subunit	Saccharomonospora viridis DSM 43017 Gene: Svir_26520: Phenylacetate-CoA oxygenase, PaaB subunit	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_3545: Phenylacetate-CoA oxygenase, PaaB subunit	Phenylacetate-CoA oxygenase, PaaB subunit
paaC	Nocardioides sp. JS614 Gene: Noca_3157: Phenylacetate-CoA oxygenase, PaaC subunit	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	Acidothermus cellulolyticus 11B Gene: Acel_1441: Phenylacetate-CoA oxygenase, PaaC subunit	Nakamurella multipartita DSM 44233 Gene: Namu_2489: Phenylacetate-CoA oxygenase, PaaC subunit	Actinosynnema mirum DSM 43827 Gene: Amir_6690: Phenylacetate-CoA oxygenase, PaaC subunit	Saccharomonospora viridis DSM 43017 Gene: Svir_26510: Phenylacetate-CoA oxygenase, PaaC subunit	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_3546: Phenylacetate-CoA oxygenase, PaaC subunit	Phenylacetate-CoA oxygenase, PaaC subunit
paaD	Nocardioides sp. JS614 Gene: Noca_3156: Phenylacetate-CoA oxygenase, PaaD subunit	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	Acidothermus cellulolyticus 11B Gene: Acel_1440: Phenylacetate-CoA oxygenase, PaaD subunit	Nakamurella multipartita DSM 44233 Gene: Namu_2488: Phenylacetate-CoA oxygenase, PaaD subunit	Actinosynnema mirum DSM 43827 Gene: Amir_6689: Phenylacetate-CoA oxygenase, PaaD subunit	Saccharomonospora viridis DSM 43017 Gene: Svir_26500: Phenylacetate-CoA oxygenase, PaaD subunit	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_3547: Phenylacetate-CoA oxygenase, PaaD subunit	Phenylacetate-CoA oxygenase, PaaD subunit
paaE	Nocardioides sp. JS614 Gene: Noca_3155: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	Acidothermus cellulolyticus 11B Gene: Acel_1439: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Nakamurella multipartita DSM 44233 Gene: Namu_2487: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Actinosynnema mirum DSM 43827 Gene: Amir_6688: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Saccharomonospora viridis DSM 43017 Gene: Svir_26490: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_3548: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Namu_2486	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	Acidothermus cellulolyticus 11B	Nakamurella multipartita DSM 44233 Gene: Namu_2486: hypothetical protein	Actinosynnema mirum DSM 43827	Saccharomonospora viridis DSM 43017	Saccharopolyspora erythraea NRRL 2338	hypothetical protein
paaZ	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	* Acidothermus cellulolyticus 11B Site: position = -177 score = 5.33565 sequence = GCCGACCGAACGTTCGGTCTAG Gene: Acel_1435: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Nakamurella multipartita DSM 44233 Gene: Namu_2485: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Actinosynnema mirum DSM 43827	* Saccharomonospora viridis DSM 43017 Site: position = -39 score = 5.34266 sequence = ACTTCCTGAACGTTCGGTTGGT Gene: Svir_26540: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	* Saccharopolyspora erythraea NRRL 2338 Site: position = -186 score = 5.46792 sequence = ACTGACCGAGTAGTCGGTTATT Site: position = -52 score = 5.45253 sequence = CGTTACCGAACGAACGGTCGGT Site: position = -48 score = 5.4452 sequence = ACCGAACGAACGGTCGGTAAAA Gene: SACE_3543: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaR	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	Acidothermus cellulolyticus 11B Gene: Acel_1436: Transcriptional regulator of phenylacetic acid degradation, TetR family	* Nakamurella multipartita DSM 44233 Site: position = -43 score = 5.95483 sequence = ACTGACCGAATGATCGGTCAGC Gene: Namu_2483: Transcriptional regulator of phenylacetic acid degradation, TetR family	Actinosynnema mirum DSM 43827	Saccharomonospora viridis DSM 43017 Gene: Svir_26580: Transcriptional regulator of phenylacetic acid degradation, TetR family	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_3541: Transcriptional regulator of phenylacetic acid degradation, TetR family	Transcriptional regulator of phenylacetic acid degradation, TetR family
paaH	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	Acidothermus cellulolyticus 11B Gene: Acel_0147: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)	Nakamurella multipartita DSM 44233 Gene: Namu_2482: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)	Actinosynnema mirum DSM 43827	* Saccharomonospora viridis DSM 43017 Site: position = -116 score = 5.63002 sequence = ACTGACCGAATGGACGGTTACT Gene: Svir_26550: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)	Saccharopolyspora erythraea NRRL 2338	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaI	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	Acidothermus cellulolyticus 11B	Nakamurella multipartita DSM 44233 Gene: Namu_2481: Phenylacetic acid degradation protein PaaI, thioesterase	Actinosynnema mirum DSM 43827	* Saccharomonospora viridis DSM 43017 Site: position = -42 score = 5.63002 sequence = AGTAACCGTCCATTCGGTCAGT Gene: Svir_26560: Phenylacetic acid degradation protein PaaI, thioesterase	Saccharopolyspora erythraea NRRL 2338	Phenylacetic acid degradation protein PaaI, thioesterase
paaK	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Frankia sp. CcI3	Frankia sp. EAN1pec	Acidothermus cellulolyticus 11B	Nakamurella multipartita DSM 44233	Actinosynnema mirum DSM 43827	Saccharomonospora viridis DSM 43017 Gene: Svir_26570: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	* Saccharopolyspora erythraea NRRL 2338 Site: position = -232 score = 5.4452 sequence = TTTTACCGACCGTTCGTTCGGT Site: position = -228 score = 5.45253 sequence = ACCGACCGTTCGTTCGGTAACG Site: position = -94 score = 5.46792 sequence = AATAACCGACTACTCGGTCAGT Gene: SACE_3542: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PaaR - Frankineae/Propionibacterineae/Pseudonocardiaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --