Regulon of PaaR in Saccharopolyspora erythraea NRRL 2338

Properties
Regulator type:	Transcription factor
TF locus tag:	SACE_3541
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -186 Score: 5.5 Sequence: ACTGACCGAGTAGTCGGTTATT Position: -52 Score: 5.5 Sequence: CGTTACCGAACGAACGGTCGGT Position: -48 Score: 5.4 Sequence: ACCGAACGAACGGTCGGTAAAA Locus tag: SACE_3543 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: SACE_3544 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: SACE_3545 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: SACE_3546 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: SACE_3547 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: SACE_3548 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	SACE_3543	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	SACE_3544	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	SACE_3545	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	SACE_3546	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	SACE_3547	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	SACE_3548	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Position: -232 Score: 5.4 Sequence: TTTTACCGACCGTTCGTTCGGT Position: -228 Score: 5.5 Sequence: ACCGACCGTTCGTTCGGTAACG Position: -94 Score: 5.5 Sequence: AATAACCGACTACTCGGTCAGT Locus tag: SACE_3542 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: SACE_3541 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	SACE_3542	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	SACE_3541	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD