Regulon of PaaR in Acidothermus cellulolyticus 11B

Properties
Regulator type:	Transcription factor
TF locus tag:	Acel_1436
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 5.3 Sequence: GCCGACCGAACGTTCGGTCTAG Locus tag: Acel_1435 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: Acel_1436 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	Acel_1435	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Acel_1436	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -41 Score: 5.7 Sequence: GTCAACCGAACATTCGGTCGGT Locus tag: Acel_1443 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Acel_1442 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Acel_1441 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Acel_1440 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Acel_1439 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Acel_1443	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Acel_1442	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Acel_1441	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Acel_1440	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Acel_1439	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD