Regulog SO3494 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 3 | 2 |
| Shewanella putrefaciens CN-32 | 3 | 2 |
| Shewanella sp W3-18-1 | 3 | 2 |
| Shewanella sp ANA-3 | 3 | 2 |
| Shewanella sp MR-4 | 3 | 2 |
| Shewanella sp MR-7 | 3 | 2 |
| Shewanella baltica OS155 | 3 | 2 |
| Shewanella denitrificans OS217 | 2 | 1 |
| Shewanella frigidimarina NCIMB 400 | 3 | 2 |
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO3494 |
*
Shewanella oneidensis MR-1 Site: position = -273 score = 6.24162 sequence = TAAATACCGATTGGTAAAAA Gene: SO_3494: Transcriptional regulator, TetR family |
*
Shewanella putrefaciens CN-32 Site: position = -266 score = 5.94883 sequence = TATGTACCGACTGGTATTAA Site: position = -339 score = 5.99244 sequence = TAAATACCGACTGGTAAAAA Gene: Sputcn32_2793: Transcriptional regulator, TetR family |
*
Shewanella sp W3-18-1 Site: position = -266 score = 5.94883 sequence = TATGTACCGACTGGTATTAA Site: position = -339 score = 5.99244 sequence = TAAATACCGACTGGTAAAAA Gene: Sputw3181_1219: Transcriptional regulator, TetR family |
*
Shewanella sp ANA-3 Site: position = -213 score = 5.20216 sequence = TTTGTACCGATGAGTATTTA Site: position = -285 score = 5.99244 sequence = TAAATACCGACTGGTAAAAA Gene: Shewana3_1076: Transcriptional regulator, TetR family |
*
Shewanella sp MR-4 Site: position = -216 score = 5.20216 sequence = TTTGTACCGATAAGTATTTA Site: position = -289 score = 5.99244 sequence = TAAATACCGACTGGTAAAAA Gene: Shewmr4_1072: Transcriptional regulator, TetR family |
*
Shewanella sp MR-7 Site: position = -288 score = 6.24162 sequence = TAAATACCGATTGGTAAAAA Site: position = -215 score = 5.20216 sequence = TTTGTACCGATAAGTATTTA Gene: Shewmr7_1144: Transcriptional regulator, TetR family |
*
Shewanella baltica OS155 Site: position = -502 score = 6.19802 sequence = TATGTACCGATTGGTATTAA Gene: Sbal_3183: Transcriptional regulator, TetR family |
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -262 score = 6.25193 sequence = TTTGTACCGATTGGTATTAA Site: position = -334 score = 6.30585 sequence = TTTATACCAATCGGTACAAA Gene: Sfri_3984: Transcriptional regulator, TetR family |
|
|
|
|
|
|
|
Transcriptional regulator, TetR family |
| CRON 2. | |||||||||||||||||
| mexE |
*
Shewanella oneidensis MR-1 Site: position = 99 score = 6.24162 sequence = TTTtTACCAATCGGTATttA Gene: SO_3493: RND multidrug efflux membrane fusion protein MexE |
*
Shewanella putrefaciens CN-32 Site: position = -97 score = 5.99244 sequence = TTTTTACCAGTCGGTATTTA Site: position = -170 score = 5.94883 sequence = TTAATACCAGTCGGTACATA Gene: Sputcn32_2792: RND multidrug efflux membrane fusion protein MexE |
*
Shewanella sp W3-18-1 Site: position = -170 score = 5.94883 sequence = TTAATACCAGTCGGTACATA Site: position = -97 score = 5.99244 sequence = TTTTTACCAGTCGGTATTTA Gene: Sputw3181_1220: RND multidrug efflux membrane fusion protein MexE |
*
Shewanella sp ANA-3 Site: position = -166 score = 5.20216 sequence = TAAATACTCATCGGTACAAA Site: position = -94 score = 5.99244 sequence = TTTTTACCAGTCGGTATTTA Gene: Shewana3_1077: RND multidrug efflux membrane fusion protein MexE |
*
Shewanella sp MR-4 Site: position = -166 score = 5.20216 sequence = TAAATACTTATCGGTACAAA Site: position = -93 score = 5.99244 sequence = TTTTTACCAGTCGGTATTTA Gene: Shewmr4_1073: RND multidrug efflux membrane fusion protein MexE |
*
Shewanella sp MR-7 Site: position = -93 score = 6.24162 sequence = TTTTTACCAATCGGTATTTA Site: position = -166 score = 5.20216 sequence = TAAATACTTATCGGTACAAA Gene: Shewmr7_1145: RND multidrug efflux membrane fusion protein MexE |
*
Shewanella baltica OS155 Site: position = -72 score = 5.99244 sequence = TTTTTACCAGTCGGTATTTA Site: position = -145 score = 6.19802 sequence = TTAATACCAATCGGTACATA Gene: Sbal_3182: RND multidrug efflux membrane fusion protein MexE |
*
Shewanella denitrificans OS217 Site: position = -70 score = 5.23755 sequence = ATCATACCGACCGGTACAAA Site: position = -119 score = 5.80998 sequence = AAATTACCAATCGGTACAAA Gene: Sden_3079: RND multidrug efflux membrane fusion protein MexE |
*
Shewanella frigidimarina NCIMB 400 Site: position = -169 score = 6.25193 sequence = TTAATACCAATCGGTACAAA Site: position = -97 score = 6.30585 sequence = TTTGTACCGATTGGTATAAA Gene: Sfri_3985: RND multidrug efflux membrane fusion protein MexE |
|
|
|
|
|
|
|
RND multidrug efflux membrane fusion protein MexE |
| mexF |
Gene: SO_3492: Acriflavin resistance protein |
Gene: Sputcn32_2791: Acriflavin resistance protein |
Gene: Sputw3181_1221: Acriflavin resistance protein |
Gene: Shewana3_1078: Acriflavin resistance protein |
Gene: Shewmr4_1074: Acriflavin resistance protein |
Gene: Shewmr7_1146: Acriflavin resistance protein |
Gene: Sbal_3181: Acriflavin resistance protein |
Gene: Sden_3080: Acriflavin resistance protein |
Gene: Sfri_3986: Acriflavin resistance protein |
|
|
|
|
|
|
|
Acriflavin resistance protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |