Regulon of SO3494 in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_3078
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO3494 - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 5.8 Sequence: AAATTACCAATCGGTACAAA Position: -70 Score: 5.2 Sequence: ATCATACCGACCGGTACAAA Locus tag: Sden_3079 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Sden_3080 Name: mexF Funciton: Acriflavin resistance protein
	Sden_3079	mexE	RND multidrug efflux membrane fusion protein MexE
	Sden_3080	mexF	Acriflavin resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD