Regulon of SO3494 in Shewanella baltica OS155

Properties
Regulator type:	Transcription factor
TF locus tag:	Sbal_3183
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO3494 - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -502 Score: 6.2 Sequence: TATGTACCGATTGGTATTAA Locus tag: Sbal_3183 Name: SO3494 Funciton: Transcriptional regulator, TetR family
	Sbal_3183	SO3494	Transcriptional regulator, TetR family
Position: -145 Score: 6.2 Sequence: TTAATACCAATCGGTACATA Position: -72 Score: 6 Sequence: TTTTTACCAGTCGGTATTTA Locus tag: Sbal_3182 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Sbal_3181 Name: mexF Funciton: Acriflavin resistance protein
	Sbal_3182	mexE	RND multidrug efflux membrane fusion protein MexE
	Sbal_3181	mexF	Acriflavin resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD