Regulon of SO3494 in Shewanella sp ANA-3

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewana3_1076
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO3494 - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -285 Score: 6 Sequence: TAAATACCGACTGGTAAAAA Position: -213 Score: 5.2 Sequence: TTTGTACCGATGAGTATTTA Locus tag: Shewana3_1076 Name: SO3494 Funciton: Transcriptional regulator, TetR family
	Shewana3_1076	SO3494	Transcriptional regulator, TetR family
Position: -166 Score: 5.2 Sequence: TAAATACTCATCGGTACAAA Position: -94 Score: 6 Sequence: TTTTTACCAGTCGGTATTTA Locus tag: Shewana3_1077 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Shewana3_1078 Name: mexF Funciton: Acriflavin resistance protein
	Shewana3_1077	mexE	RND multidrug efflux membrane fusion protein MexE
	Shewana3_1078	mexF	Acriflavin resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD