Regulon of SO3494 in Shewanella putrefaciens CN-32

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputcn32_2793
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO3494 - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -170 Score: 5.9 Sequence: TTAATACCAGTCGGTACATA Position: -97 Score: 6 Sequence: TTTTTACCAGTCGGTATTTA Locus tag: Sputcn32_2792 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Sputcn32_2791 Name: mexF Funciton: Acriflavin resistance protein
	Sputcn32_2792	mexE	RND multidrug efflux membrane fusion protein MexE
	Sputcn32_2791	mexF	Acriflavin resistance protein
Position: -339 Score: 6 Sequence: TAAATACCGACTGGTAAAAA Position: -266 Score: 5.9 Sequence: TATGTACCGACTGGTATTAA Locus tag: Sputcn32_2793 Name: SO3494 Funciton: Transcriptional regulator, TetR family
	Sputcn32_2793	SO3494	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD