Regulon of SO3494 in Shewanella frigidimarina NCIMB 400

Properties
Regulator type:	Transcription factor
TF locus tag:	Sfri_3984
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO3494 - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -169 Score: 6.3 Sequence: TTAATACCAATCGGTACAAA Position: -97 Score: 6.3 Sequence: TTTGTACCGATTGGTATAAA Locus tag: Sfri_3985 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Sfri_3986 Name: mexF Funciton: Acriflavin resistance protein
	Sfri_3985	mexE	RND multidrug efflux membrane fusion protein MexE
	Sfri_3986	mexF	Acriflavin resistance protein
Position: -334 Score: 6.3 Sequence: TTTATACCAATCGGTACAAA Position: -262 Score: 6.3 Sequence: TTTGTACCGATTGGTATTAA Locus tag: Sfri_3984 Name: SO3494 Funciton: Transcriptional regulator, TetR family
	Sfri_3984	SO3494	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD