Regulog PhrR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Blue light; Adenosylcobalamin
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PhrR
By TF family - MerR
By effector - Blue light
By effector - Adenosylcobalamin
By pathway - Light-dependent DNA repair

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	12	2
Shewanella putrefaciens CN-32	12	2
Shewanella sp W3-18-1	12	2
Shewanella sp ANA-3	12	2
Shewanella sp MR-4	12	2
Shewanella sp MR-7	12	2
Shewanella baltica OS155	12	2
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO3420	* Shewanella oneidensis MR-1 Site: position = -70 score = 6.45302 sequence = AGTACATTAAGTTAATTTGTGTACA Gene: SO3420: cytochrome c, class II	* Shewanella putrefaciens CN-32 Site: position = -70 score = 6.42006 sequence = AGTACATCAAGTTAATTTGTGTACA Gene: Sputcn32_2738: cytochrome c, class II	* Shewanella sp W3-18-1 Site: position = -70 score = 6.42006 sequence = AGTACATCAAGTTAATTTGTGTACA Gene: Sputw3181_1274: cytochrome c, class II	* Shewanella sp ANA-3 Site: position = -70 score = 6.38882 sequence = AGTACATTGAGTTAATTTGTGTACA Gene: Shewana3_1135: cytochrome c, class II	* Shewanella sp MR-4 Site: position = -70 score = 6.38882 sequence = AGTACATTGAGTTAATTTGTGTACA Gene: Shewmr4_1134: cytochrome c, class II	* Shewanella sp MR-7 Site: position = -70 score = 6.38882 sequence = AGTACATTGAGTTAATTTGTGTACA Gene: Shewmr7_1205: cytochrome c, class II	* Shewanella baltica OS155 Site: position = -70 score = 6.42006 sequence = AGTACATCAAGTTAATTTGTGTACA Gene: Sbal_1223: cytochrome c, class II	Shewanella denitrificans OS217 Gene: Sden_2744: cytochrome c, class II	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2910: cytochrome c, class II	Shewanella amazonensis SB2B Gene: Sama_0901: cytochrome c, class II	Shewanella loihica PV-4 Gene: Shew_1075: cytochrome c, class II	Shewanella pealeana ATCC 700345 Gene: Spea_1062: cytochrome c, class II	Shewanella halifaxensis HAW-EB4 Gene: Shal_1110: cytochrome c, class II	Shewanella piezotolerans WP3 Gene: swp_3755: cytochrome c, class II	Shewanella sediminis HAW-EB3 Gene: Ssed_1171: cytochrome c, class II	Shewanella woodyi ATCC 51908 Gene: Swoo_1266: cytochrome c, class II	cytochrome c, class II

CRON 2.
COG3272	* Shewanella oneidensis MR-1 Site: position = -70 score = 6.64681 sequence = TGTACAAAAACTTGATCCTTGTACA Site: position = -18 score = 4.77092 sequence = GATACAAGGAATCTCATTATGTACA Gene: SO3386: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Shewanella putrefaciens CN-32 Site: position = -70 score = 6.76233 sequence = TGTACAAAAACTTGATCTTTGTACA Site: position = -18 score = 5.50263 sequence = TATACAAGGAGTCAGATTATGTATA Gene: Sputcn32_2716: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Shewanella sp W3-18-1 Site: position = -70 score = 6.76233 sequence = TGTACAAAAACTTGATCTTTGTACA Site: position = -18 score = 5.50263 sequence = TATACAAGGAGTCAGATTATGTATA Gene: Sputw3181_1296: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Shewanella sp ANA-3 Site: position = -70 score = 6.64681 sequence = TGTACAAAAACTTGATCCTTGTACA Site: position = -18 score = 5.45311 sequence = GATACAAGGAATAGCATTATGTACA Gene: Shewana3_1164: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Shewanella sp MR-4 Site: position = -70 score = 6.64681 sequence = TGTACAAAAACTTGATCCTTGTACA Site: position = -18 score = 5.45311 sequence = GATACAAGGAATAGCATTATGTACA Gene: Shewmr4_1163: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Shewanella sp MR-7 Site: position = -70 score = 6.64681 sequence = TGTACAAAAACTTGATCCTTGTACA Site: position = -18 score = 5.45311 sequence = GATACAAGGAATAGCATTATGTACA Gene: Shewmr7_1234: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Shewanella baltica OS155 Site: position = -70 score = 6.39613 sequence = TATACAAAAACTTGATCCTTGTACA Site: position = -18 score = 5.29273 sequence = GATACAAGGAGTCGACTTATGTACA Gene: Sbal_3056: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	Shewanella denitrificans OS217 Gene: Sden_2839: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3039: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	Shewanella amazonensis SB2B Gene: Sama_0810: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	Shewanella loihica PV-4 Gene: Shew_1478: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2778: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
phrR	Shewanella oneidensis MR-1 Gene: SO3385: Transcriptional regulator, MerR family, associated with photolyase	Shewanella putrefaciens CN-32 Gene: Sputcn32_2715: Transcriptional regulator, MerR family, associated with photolyase	Shewanella sp W3-18-1 Gene: Sputw3181_1297: Transcriptional regulator, MerR family, associated with photolyase	Shewanella sp ANA-3 Gene: Shewana3_1165: Transcriptional regulator, MerR family, associated with photolyase	Shewanella sp MR-4 Gene: Shewmr4_1164: Transcriptional regulator, MerR family, associated with photolyase	Shewanella sp MR-7 Gene: Shewmr7_1235: Transcriptional regulator, MerR family, associated with photolyase	Shewanella baltica OS155 Gene: Sbal_3055: Transcriptional regulator, MerR family, associated with photolyase	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Transcriptional regulator, MerR family, associated with photolyase
phr	Shewanella oneidensis MR-1 Gene: SO3384: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella putrefaciens CN-32 Gene: Sputcn32_2714: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella sp W3-18-1 Gene: Sputw3181_1298: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella sp ANA-3 Gene: Shewana3_1166: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella sp MR-4 Gene: Shewmr4_1165: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella sp MR-7 Gene: Shewmr7_1236: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella baltica OS155 Gene: Sbal_3054: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella denitrificans OS217 Gene: Sden_2838: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3038: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella amazonensis SB2B Gene: Sama_0811: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella loihica PV-4 Gene: Shew_1479: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2777: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
PF10184	Shewanella oneidensis MR-1 Gene: SO3383: Protein of unknown function DUF2358	Shewanella putrefaciens CN-32 Gene: Sputcn32_2713: Protein of unknown function DUF2358	Shewanella sp W3-18-1 Gene: Sputw3181_1299: Protein of unknown function DUF2358	Shewanella sp ANA-3 Gene: Shewana3_1167: Protein of unknown function DUF2358	Shewanella sp MR-4 Gene: Shewmr4_1166: Protein of unknown function DUF2358	Shewanella sp MR-7 Gene: Shewmr7_1237: Protein of unknown function DUF2358	Shewanella baltica OS155 Gene: Sbal_3053: Protein of unknown function DUF2358	Shewanella denitrificans OS217 Gene: Sden_3372: Protein of unknown function DUF2358	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3035: Protein of unknown function DUF2358	Shewanella amazonensis SB2B Gene: Sama_0812: Protein of unknown function DUF2358	Shewanella loihica PV-4 Gene: Shew_1480: Protein of unknown function DUF2358	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2776: Protein of unknown function DUF2358	Protein of unknown function DUF2358
PF00106	Shewanella oneidensis MR-1 Gene: SO3382: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella putrefaciens CN-32 Gene: Sputcn32_2712: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella sp W3-18-1 Gene: Sputw3181_1300: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella sp ANA-3 Gene: Shewana3_1168: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella sp MR-4 Gene: Shewmr4_1167: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella sp MR-7 Gene: Shewmr7_1238: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella baltica OS155 Gene: Sbal_3052: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella denitrificans OS217 Gene: Sden_3371: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3034: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella amazonensis SB2B Gene: Sama_0813: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella loihica PV-4 Gene: Shew_1481: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2775: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
PF01593	Shewanella oneidensis MR-1 Gene: SO3381: Flavin containing amine oxidoreductase	Shewanella putrefaciens CN-32 Gene: Sputcn32_2711: Flavin containing amine oxidoreductase	Shewanella sp W3-18-1 Gene: Sputw3181_1301: Flavin containing amine oxidoreductase	Shewanella sp ANA-3 Gene: Shewana3_1169: Flavin containing amine oxidoreductase	Shewanella sp MR-4 Gene: Shewmr4_1168: Flavin containing amine oxidoreductase	Shewanella sp MR-7 Gene: Shewmr7_1239: Flavin containing amine oxidoreductase	Shewanella baltica OS155 Gene: Sbal_3051: Flavin containing amine oxidoreductase	Shewanella denitrificans OS217 Gene: Sden_3370: Flavin containing amine oxidoreductase	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3033: Flavin containing amine oxidoreductase	Shewanella amazonensis SB2B Gene: Sama_0814: Flavin containing amine oxidoreductase	Shewanella loihica PV-4 Gene: Shew_1482: Flavin containing amine oxidoreductase	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2774: Flavin containing amine oxidoreductase	Flavin containing amine oxidoreductase
PF07103	Shewanella oneidensis MR-1 Gene: SO3380: Protein of unknown function DUF1365	Shewanella putrefaciens CN-32 Gene: Sputcn32_2710: Protein of unknown function DUF1365	Shewanella sp W3-18-1 Gene: Sputw3181_1302: Protein of unknown function DUF1365	Shewanella sp ANA-3 Gene: Shewana3_1170: Protein of unknown function DUF1365	Shewanella sp MR-4 Gene: Shewmr4_1169: Protein of unknown function DUF1365	Shewanella sp MR-7 Gene: Shewmr7_1240: Protein of unknown function DUF1365	Shewanella baltica OS155 Gene: Sbal_3050: Protein of unknown function DUF1365	Shewanella denitrificans OS217 Gene: Sden_3369: Protein of unknown function DUF1365	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3032: Protein of unknown function DUF1365	Shewanella amazonensis SB2B Gene: Sama_0815: Protein of unknown function DUF1365	Shewanella loihica PV-4 Gene: Shew_1483: Protein of unknown function DUF1365	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2773: Protein of unknown function DUF1365	Protein of unknown function DUF1365
PF02353	Shewanella oneidensis MR-1 Gene: SO3379: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella putrefaciens CN-32 Gene: Sputcn32_2709: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella sp W3-18-1 Gene: Sputw3181_1303: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella sp ANA-3 Gene: Shewana3_1171: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella sp MR-4 Gene: Shewmr4_1170: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella sp MR-7 Gene: Shewmr7_1241: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella baltica OS155 Gene: Sbal_3049: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella denitrificans OS217 Gene: Sden_3368: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3031: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella amazonensis SB2B Gene: Sama_0816: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella loihica PV-4 Gene: Shew_1484: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2772: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
PF11086	Shewanella oneidensis MR-1 Gene: SO3378: Protein of unknown function DUF2878	Shewanella putrefaciens CN-32 Gene: Sputcn32_2708: Protein of unknown function DUF2878	Shewanella sp W3-18-1 Gene: Sputw3181_1304: Protein of unknown function DUF2878	Shewanella sp ANA-3 Gene: Shewana3_1172: Protein of unknown function DUF2878	Shewanella sp MR-4 Gene: Shewmr4_1171: Protein of unknown function DUF2878	Shewanella sp MR-7 Gene: Shewmr7_1242: Protein of unknown function DUF2878	Shewanella baltica OS155 Gene: Sbal_3048: Protein of unknown function DUF2878	Shewanella denitrificans OS217 Gene: Sden_3367: Protein of unknown function DUF2878	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3030: Protein of unknown function DUF2878	Shewanella amazonensis SB2B Gene: Sama_0817: Protein of unknown function DUF2878	Shewanella loihica PV-4 Gene: Shew_1485: Protein of unknown function DUF2878	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2771: Protein of unknown function DUF2878	Protein of unknown function DUF2878
FIG026291	Shewanella oneidensis MR-1 Gene: SO3377: FIG026291: Hypothetical periplasmic protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_2707: FIG026291: Hypothetical periplasmic protein	Shewanella sp W3-18-1 Gene: Sputw3181_1305: FIG026291: Hypothetical periplasmic protein	Shewanella sp ANA-3 Gene: Shewana3_1173: FIG026291: Hypothetical periplasmic protein	Shewanella sp MR-4 Gene: Shewmr4_1172: FIG026291: Hypothetical periplasmic protein	Shewanella sp MR-7 Gene: Shewmr7_1243: FIG026291: Hypothetical periplasmic protein	Shewanella baltica OS155 Gene: Sbal_3047: FIG026291: Hypothetical periplasmic protein	Shewanella denitrificans OS217 Gene: Sden_3366: FIG026291: Hypothetical periplasmic protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3029: FIG026291: Hypothetical periplasmic protein	Shewanella amazonensis SB2B Gene: Sama_0818: FIG026291: Hypothetical periplasmic protein	Shewanella loihica PV-4 Gene: Shew_1486: FIG026291: Hypothetical periplasmic protein	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2770: FIG026291: Hypothetical periplasmic protein	FIG026291: Hypothetical periplasmic protein
FIG002577	Shewanella oneidensis MR-1 Gene: SO3376: FIG002577: Putative lipoprotein precursor	Shewanella putrefaciens CN-32 Gene: Sputcn32_2706: FIG002577: Putative lipoprotein precursor	Shewanella sp W3-18-1 Gene: Sputw3181_1306: FIG002577: Putative lipoprotein precursor	Shewanella sp ANA-3 Gene: Shewana3_1174: FIG002577: Putative lipoprotein precursor	Shewanella sp MR-4 Gene: Shewmr4_1173: FIG002577: Putative lipoprotein precursor	Shewanella sp MR-7 Gene: Shewmr7_1244: FIG002577: Putative lipoprotein precursor	Shewanella baltica OS155 Gene: Sbal_3046: FIG002577: Putative lipoprotein precursor	Shewanella denitrificans OS217 Gene: Sden_3365: FIG002577: Putative lipoprotein precursor	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3028: FIG002577: Putative lipoprotein precursor	Shewanella amazonensis SB2B Gene: Sama_0819: FIG002577: Putative lipoprotein precursor	Shewanella loihica PV-4 Gene: Shew_1487: FIG002577: Putative lipoprotein precursor	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_2769: FIG002577: Putative lipoprotein precursor	FIG002577: Putative lipoprotein precursor

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PhrR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --