Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog PhrR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Blue light; Adenosylcobalamin
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 12 2
Shewanella putrefaciens CN-32 12 2
Shewanella sp W3-18-1 12 2
Shewanella sp ANA-3 12 2
Shewanella sp MR-4 12 2
Shewanella sp MR-7 12 2
Shewanella baltica OS155 12 2
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SO3420
*
Shewanella oneidensis MR-1

Site:
position = -70
score = 6.45302
sequence = AGTACATTAAGTTAATTTGTGTACA

Gene: SO3420: cytochrome c, class II
*
Shewanella putrefaciens CN-32

Site:
position = -70
score = 6.42006
sequence = AGTACATCAAGTTAATTTGTGTACA

Gene: Sputcn32_2738: cytochrome c, class II
*
Shewanella sp W3-18-1

Site:
position = -70
score = 6.42006
sequence = AGTACATCAAGTTAATTTGTGTACA

Gene: Sputw3181_1274: cytochrome c, class II
*
Shewanella sp ANA-3

Site:
position = -70
score = 6.38882
sequence = AGTACATTGAGTTAATTTGTGTACA

Gene: Shewana3_1135: cytochrome c, class II
*
Shewanella sp MR-4

Site:
position = -70
score = 6.38882
sequence = AGTACATTGAGTTAATTTGTGTACA

Gene: Shewmr4_1134: cytochrome c, class II
*
Shewanella sp MR-7

Site:
position = -70
score = 6.38882
sequence = AGTACATTGAGTTAATTTGTGTACA

Gene: Shewmr7_1205: cytochrome c, class II
*
Shewanella baltica OS155

Site:
position = -70
score = 6.42006
sequence = AGTACATCAAGTTAATTTGTGTACA

Gene: Sbal_1223: cytochrome c, class II
 
Shewanella denitrificans OS217

Gene: Sden_2744: cytochrome c, class II
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2910: cytochrome c, class II
 
Shewanella amazonensis SB2B

Gene: Sama_0901: cytochrome c, class II
 
Shewanella loihica PV-4

Gene: Shew_1075: cytochrome c, class II
 
Shewanella pealeana ATCC 700345

Gene: Spea_1062: cytochrome c, class II
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1110: cytochrome c, class II
 
Shewanella piezotolerans WP3

Gene: swp_3755: cytochrome c, class II
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1171: cytochrome c, class II
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1266: cytochrome c, class II
cytochrome c, class II
 
CRON 2.
COG3272
*
Shewanella oneidensis MR-1

Site:
position = -70
score = 6.64681
sequence = TGTACAAAAACTTGATCCTTGTACA

Site:
position = -18
score = 4.77092
sequence = GATACAAGGAATCTCATTATGTACA

Gene: SO3386: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Shewanella putrefaciens CN-32

Site:
position = -70
score = 6.76233
sequence = TGTACAAAAACTTGATCTTTGTACA

Site:
position = -18
score = 5.50263
sequence = TATACAAGGAGTCAGATTATGTATA

Gene: Sputcn32_2716: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Shewanella sp W3-18-1

Site:
position = -70
score = 6.76233
sequence = TGTACAAAAACTTGATCTTTGTACA

Site:
position = -18
score = 5.50263
sequence = TATACAAGGAGTCAGATTATGTATA

Gene: Sputw3181_1296: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Shewanella sp ANA-3

Site:
position = -70
score = 6.64681
sequence = TGTACAAAAACTTGATCCTTGTACA

Site:
position = -18
score = 5.45311
sequence = GATACAAGGAATAGCATTATGTACA

Gene: Shewana3_1164: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Shewanella sp MR-4

Site:
position = -70
score = 6.64681
sequence = TGTACAAAAACTTGATCCTTGTACA

Site:
position = -18
score = 5.45311
sequence = GATACAAGGAATAGCATTATGTACA

Gene: Shewmr4_1163: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Shewanella sp MR-7

Site:
position = -70
score = 6.64681
sequence = TGTACAAAAACTTGATCCTTGTACA

Site:
position = -18
score = 5.45311
sequence = GATACAAGGAATAGCATTATGTACA

Gene: Shewmr7_1234: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Shewanella baltica OS155

Site:
position = -70
score = 6.39613
sequence = TATACAAAAACTTGATCCTTGTACA

Site:
position = -18
score = 5.29273
sequence = GATACAAGGAGTCGACTTATGTACA

Gene: Sbal_3056: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Shewanella denitrificans OS217

Gene: Sden_2839: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3039: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Shewanella amazonensis SB2B

Gene: Sama_0810: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Shewanella loihica PV-4

Gene: Shew_1478: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2778: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
phrR
 
Shewanella oneidensis MR-1

Gene: SO3385: Transcriptional regulator, MerR family, associated with photolyase
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2715: Transcriptional regulator, MerR family, associated with photolyase
 
Shewanella sp W3-18-1

Gene: Sputw3181_1297: Transcriptional regulator, MerR family, associated with photolyase
 
Shewanella sp ANA-3

Gene: Shewana3_1165: Transcriptional regulator, MerR family, associated with photolyase
 
Shewanella sp MR-4

Gene: Shewmr4_1164: Transcriptional regulator, MerR family, associated with photolyase
 
Shewanella sp MR-7

Gene: Shewmr7_1235: Transcriptional regulator, MerR family, associated with photolyase
 
Shewanella baltica OS155

Gene: Sbal_3055: Transcriptional regulator, MerR family, associated with photolyase
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Transcriptional regulator, MerR family, associated with photolyase
phr
 
Shewanella oneidensis MR-1

Gene: SO3384: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2714: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella sp W3-18-1

Gene: Sputw3181_1298: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella sp ANA-3

Gene: Shewana3_1166: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella sp MR-4

Gene: Shewmr4_1165: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella sp MR-7

Gene: Shewmr7_1236: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella baltica OS155

Gene: Sbal_3054: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella denitrificans OS217

Gene: Sden_2838: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3038: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella amazonensis SB2B

Gene: Sama_0811: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella loihica PV-4

Gene: Shew_1479: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2777: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
PF10184
 
Shewanella oneidensis MR-1

Gene: SO3383: Protein of unknown function DUF2358
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2713: Protein of unknown function DUF2358
 
Shewanella sp W3-18-1

Gene: Sputw3181_1299: Protein of unknown function DUF2358
 
Shewanella sp ANA-3

Gene: Shewana3_1167: Protein of unknown function DUF2358
 
Shewanella sp MR-4

Gene: Shewmr4_1166: Protein of unknown function DUF2358
 
Shewanella sp MR-7

Gene: Shewmr7_1237: Protein of unknown function DUF2358
 
Shewanella baltica OS155

Gene: Sbal_3053: Protein of unknown function DUF2358
 
Shewanella denitrificans OS217

Gene: Sden_3372: Protein of unknown function DUF2358
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3035: Protein of unknown function DUF2358
 
Shewanella amazonensis SB2B

Gene: Sama_0812: Protein of unknown function DUF2358
 
Shewanella loihica PV-4

Gene: Shew_1480: Protein of unknown function DUF2358
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2776: Protein of unknown function DUF2358
Protein of unknown function DUF2358
PF00106
 
Shewanella oneidensis MR-1

Gene: SO3382: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2712: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella sp W3-18-1

Gene: Sputw3181_1300: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella sp ANA-3

Gene: Shewana3_1168: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella sp MR-4

Gene: Shewmr4_1167: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella sp MR-7

Gene: Shewmr7_1238: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella baltica OS155

Gene: Sbal_3052: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella denitrificans OS217

Gene: Sden_3371: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3034: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella amazonensis SB2B

Gene: Sama_0813: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella loihica PV-4

Gene: Shew_1481: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2775: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
PF01593
 
Shewanella oneidensis MR-1

Gene: SO3381: Flavin containing amine oxidoreductase
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2711: Flavin containing amine oxidoreductase
 
Shewanella sp W3-18-1

Gene: Sputw3181_1301: Flavin containing amine oxidoreductase
 
Shewanella sp ANA-3

Gene: Shewana3_1169: Flavin containing amine oxidoreductase
 
Shewanella sp MR-4

Gene: Shewmr4_1168: Flavin containing amine oxidoreductase
 
Shewanella sp MR-7

Gene: Shewmr7_1239: Flavin containing amine oxidoreductase
 
Shewanella baltica OS155

Gene: Sbal_3051: Flavin containing amine oxidoreductase
 
Shewanella denitrificans OS217

Gene: Sden_3370: Flavin containing amine oxidoreductase
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3033: Flavin containing amine oxidoreductase
 
Shewanella amazonensis SB2B

Gene: Sama_0814: Flavin containing amine oxidoreductase
 
Shewanella loihica PV-4

Gene: Shew_1482: Flavin containing amine oxidoreductase
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2774: Flavin containing amine oxidoreductase
Flavin containing amine oxidoreductase
PF07103
 
Shewanella oneidensis MR-1

Gene: SO3380: Protein of unknown function DUF1365
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2710: Protein of unknown function DUF1365
 
Shewanella sp W3-18-1

Gene: Sputw3181_1302: Protein of unknown function DUF1365
 
Shewanella sp ANA-3

Gene: Shewana3_1170: Protein of unknown function DUF1365
 
Shewanella sp MR-4

Gene: Shewmr4_1169: Protein of unknown function DUF1365
 
Shewanella sp MR-7

Gene: Shewmr7_1240: Protein of unknown function DUF1365
 
Shewanella baltica OS155

Gene: Sbal_3050: Protein of unknown function DUF1365
 
Shewanella denitrificans OS217

Gene: Sden_3369: Protein of unknown function DUF1365
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3032: Protein of unknown function DUF1365
 
Shewanella amazonensis SB2B

Gene: Sama_0815: Protein of unknown function DUF1365
 
Shewanella loihica PV-4

Gene: Shew_1483: Protein of unknown function DUF1365
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2773: Protein of unknown function DUF1365
Protein of unknown function DUF1365
PF02353
 
Shewanella oneidensis MR-1

Gene: SO3379: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2709: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella sp W3-18-1

Gene: Sputw3181_1303: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella sp ANA-3

Gene: Shewana3_1171: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella sp MR-4

Gene: Shewmr4_1170: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella sp MR-7

Gene: Shewmr7_1241: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella baltica OS155

Gene: Sbal_3049: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella denitrificans OS217

Gene: Sden_3368: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3031: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella amazonensis SB2B

Gene: Sama_0816: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella loihica PV-4

Gene: Shew_1484: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2772: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
PF11086
 
Shewanella oneidensis MR-1

Gene: SO3378: Protein of unknown function DUF2878
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2708: Protein of unknown function DUF2878
 
Shewanella sp W3-18-1

Gene: Sputw3181_1304: Protein of unknown function DUF2878
 
Shewanella sp ANA-3

Gene: Shewana3_1172: Protein of unknown function DUF2878
 
Shewanella sp MR-4

Gene: Shewmr4_1171: Protein of unknown function DUF2878
 
Shewanella sp MR-7

Gene: Shewmr7_1242: Protein of unknown function DUF2878
 
Shewanella baltica OS155

Gene: Sbal_3048: Protein of unknown function DUF2878
 
Shewanella denitrificans OS217

Gene: Sden_3367: Protein of unknown function DUF2878
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3030: Protein of unknown function DUF2878
 
Shewanella amazonensis SB2B

Gene: Sama_0817: Protein of unknown function DUF2878
 
Shewanella loihica PV-4

Gene: Shew_1485: Protein of unknown function DUF2878
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2771: Protein of unknown function DUF2878
Protein of unknown function DUF2878
FIG026291
 
Shewanella oneidensis MR-1

Gene: SO3377: FIG026291: Hypothetical periplasmic protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2707: FIG026291: Hypothetical periplasmic protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1305: FIG026291: Hypothetical periplasmic protein
 
Shewanella sp ANA-3

Gene: Shewana3_1173: FIG026291: Hypothetical periplasmic protein
 
Shewanella sp MR-4

Gene: Shewmr4_1172: FIG026291: Hypothetical periplasmic protein
 
Shewanella sp MR-7

Gene: Shewmr7_1243: FIG026291: Hypothetical periplasmic protein
 
Shewanella baltica OS155

Gene: Sbal_3047: FIG026291: Hypothetical periplasmic protein
 
Shewanella denitrificans OS217

Gene: Sden_3366: FIG026291: Hypothetical periplasmic protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3029: FIG026291: Hypothetical periplasmic protein
 
Shewanella amazonensis SB2B

Gene: Sama_0818: FIG026291: Hypothetical periplasmic protein
 
Shewanella loihica PV-4

Gene: Shew_1486: FIG026291: Hypothetical periplasmic protein
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2770: FIG026291: Hypothetical periplasmic protein
FIG026291: Hypothetical periplasmic protein
FIG002577
 
Shewanella oneidensis MR-1

Gene: SO3376: FIG002577: Putative lipoprotein precursor
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2706: FIG002577: Putative lipoprotein precursor
 
Shewanella sp W3-18-1

Gene: Sputw3181_1306: FIG002577: Putative lipoprotein precursor
 
Shewanella sp ANA-3

Gene: Shewana3_1174: FIG002577: Putative lipoprotein precursor
 
Shewanella sp MR-4

Gene: Shewmr4_1173: FIG002577: Putative lipoprotein precursor
 
Shewanella sp MR-7

Gene: Shewmr7_1244: FIG002577: Putative lipoprotein precursor
 
Shewanella baltica OS155

Gene: Sbal_3046: FIG002577: Putative lipoprotein precursor
 
Shewanella denitrificans OS217

Gene: Sden_3365: FIG002577: Putative lipoprotein precursor
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3028: FIG002577: Putative lipoprotein precursor
 
Shewanella amazonensis SB2B

Gene: Sama_0819: FIG002577: Putative lipoprotein precursor
 
Shewanella loihica PV-4

Gene: Shew_1487: FIG002577: Putative lipoprotein precursor
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2769: FIG002577: Putative lipoprotein precursor
FIG002577: Putative lipoprotein precursor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise