Regulon of PhrR in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_1297
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Blue light; Adenosylcobalamin
Regulog:	PhrR - Shewanellaceae
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PhrR
By TF family - MerR
By effector - Blue light
By effector - Adenosylcobalamin
By pathway - Light-dependent DNA repair

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6.4 Sequence: AGTACATCAAGTTAATTTGTGTACA Locus tag: Sputw3181_1274 Name: SO3420 Funciton: cytochrome c, class II
	Sputw3181_1274	SO3420	cytochrome c, class II
Position: -70 Score: 6.8 Sequence: TGTACAAAAACTTGATCTTTGTACA Position: -18 Score: 5.5 Sequence: TATACAAGGAGTCAGATTATGTATA Locus tag: Sputw3181_1296 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: Sputw3181_1297 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: Sputw3181_1298 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: Sputw3181_1299 Name: PF10184 Funciton: Protein of unknown function DUF2358 Locus tag: Sputw3181_1300 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: Sputw3181_1301 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: Sputw3181_1302 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: Sputw3181_1303 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: Sputw3181_1304 Name: PF11086 Funciton: Protein of unknown function DUF2878 Locus tag: Sputw3181_1305 Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein Locus tag: Sputw3181_1306 Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor
	Sputw3181_1296	COG3272	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
	Sputw3181_1297	phrR	Transcriptional regulator, MerR family, associated with photolyase
	Sputw3181_1298	phr	Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
	Sputw3181_1299	PF10184	Protein of unknown function DUF2358
	Sputw3181_1300	PF00106	Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
	Sputw3181_1301	PF01593	Flavin containing amine oxidoreductase
	Sputw3181_1302	PF07103	Protein of unknown function DUF1365
	Sputw3181_1303	PF02353	S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
	Sputw3181_1304	PF11086	Protein of unknown function DUF2878
	Sputw3181_1305	FIG026291	FIG026291: Hypothetical periplasmic protein
	Sputw3181_1306	FIG002577	FIG002577: Putative lipoprotein precursor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD