Regulog SO1415 - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	6	3
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4	6	3
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4	6	3
Shewanella pealeana ATCC 700345	6	3
Shewanella halifaxensis HAW-EB4	6	3
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3	6	3
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO1415	* Shewanella oneidensis MR-1 Site: position = -238 score = 6.70644 sequence = ATTCGTGAGACGTCTCTTGAAT Gene: SO_1415: Transcriptional regulator, TetR family	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	* Shewanella sp MR-4 Site: position = -241 score = 6.43543 sequence = ATTCGTGAGTTATCTCGTGAAT Gene: Shewmr4_0298: Transcriptional regulator, TetR family	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	* Shewanella loihica PV-4 Site: position = -235 score = 6.27259 sequence = ATTCGTGAACCATGTCCCGAAT Gene: Shew_0277: Transcriptional regulator, TetR family	* Shewanella pealeana ATCC 700345 Site: position = -247 score = 6.77856 sequence = ATTCGTGAGTCAGCTCTCGAAT Gene: Spea_0326: Transcriptional regulator, TetR family	* Shewanella halifaxensis HAW-EB4 Site: position = -247 score = 6.68176 sequence = ATTCGTGAGGCAGCTCTCGAAT Gene: Shal_3965: Transcriptional regulator, TetR family	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -259 score = 5.87748 sequence = ATTCGTGAAGCAGATCTCGAAG Gene: Ssed_4183: Transcriptional regulator, TetR family	Shewanella woodyi ATCC 51908	Transcriptional regulator, TetR family

CRON 2.
SO1414	* Shewanella oneidensis MR-1 Site: position = -117 score = 6.70644 sequence = ATTCAAGAGACGTCTCACGAAT Gene: SO_1414: Flavocytochrome c flavin subunit	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	* Shewanella sp MR-4 Site: position = -116 score = 6.43543 sequence = ATTCACGAGATAACTCACGAAT Gene: Shewmr4_0299: Flavocytochrome c flavin subunit	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	* Shewanella loihica PV-4 Site: position = -118 score = 6.27259 sequence = ATTCGGGACATGGTTCACGAAT Gene: Shew_0276: Flavocytochrome c flavin subunit	* Shewanella pealeana ATCC 700345 Site: position = -119 score = 6.77856 sequence = ATTCGAGAGCTGACTCACGAAT Gene: Spea_0325: Flavocytochrome c flavin subunit	* Shewanella halifaxensis HAW-EB4 Site: position = -119 score = 6.68176 sequence = ATTCGAGAGCTGCCTCACGAAT Gene: Shal_3966: Flavocytochrome c flavin subunit	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -116 score = 5.87748 sequence = CTTCGAGATCTGCTTCACGAAT Gene: Ssed_4184: Flavocytochrome c flavin subunit	Shewanella woodyi ATCC 51908	Flavocytochrome c flavin subunit
SO1413	Shewanella oneidensis MR-1 Gene: SO_1413: Flavocytochrome c heme subunit	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4 Gene: Shewmr4_0300: Flavocytochrome c heme subunit	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_0275: Flavocytochrome c heme subunit	Shewanella pealeana ATCC 700345 Gene: Spea_0324: Flavocytochrome c heme subunit	Shewanella halifaxensis HAW-EB4 Gene: Shal_3967: Flavocytochrome c heme subunit	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_4185: Flavocytochrome c heme subunit	Shewanella woodyi ATCC 51908	Flavocytochrome c heme subunit
SO1412	Shewanella oneidensis MR-1 Gene: SO_1412: outer membrane beta barrel protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4 Gene: Shewmr4_0301: outer membrane beta barrel protein	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_0274: outer membrane beta barrel protein	Shewanella pealeana ATCC 700345 Gene: Spea_0323: outer membrane beta barrel protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_3968: outer membrane beta barrel protein	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_4186: outer membrane beta barrel protein	Shewanella woodyi ATCC 51908	outer membrane beta barrel protein
SO1411	Shewanella oneidensis MR-1 Gene: SO_1411: conserved hypothetical outer membrane protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4 Gene: Shewmr4_0302: conserved hypothetical outer membrane protein	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_0273: conserved hypothetical outer membrane protein	Shewanella pealeana ATCC 700345 Gene: Spea_0322: conserved hypothetical outer membrane protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_3969: conserved hypothetical outer membrane protein	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_4187: conserved hypothetical outer membrane protein	Shewanella woodyi ATCC 51908	conserved hypothetical outer membrane protein

CRON 3.
SO1410	* Shewanella oneidensis MR-1 Site: position = -163 score = 5.82093 sequence = ATTCGCGAGTAAAGTCACGAAT Gene: SO_1410: periplasmic RmlC-type Cupin domain family protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	* Shewanella sp MR-4 Site: position = -149 score = 5.82093 sequence = ATTCGCGAGTAAAGTCACGAAT Gene: Shewmr4_0303: periplasmic RmlC-type Cupin domain family protein	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	* Shewanella loihica PV-4 Site: position = -151 score = 6.34167 sequence = ATTCGCGAGCCAAGTCACGAAT Gene: Shew_0272: periplasmic RmlC-type Cupin domain family protein	* Shewanella pealeana ATCC 700345 Site: position = -157 score = 5.94785 sequence = ATTCGCGACCGAGCTCACGAAT Gene: Spea_0321: periplasmic RmlC-type Cupin domain family protein	* Shewanella halifaxensis HAW-EB4 Site: position = -156 score = 6.34167 sequence = ATTCGCGACTTGGCTCACGAAT Gene: Shal_3970: periplasmic RmlC-type Cupin domain family protein	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -154 score = 5.99514 sequence = ATTCGCGAGCTCTGTCACGAAT Gene: Ssed_4188: periplasmic RmlC-type Cupin domain family protein	Shewanella woodyi ATCC 51908	periplasmic RmlC-type Cupin domain family protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SO1415 - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --