Regulog SO1415 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 6 | 3 |
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | 6 | 3 |
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | 6 | 3 |
| Shewanella pealeana ATCC 700345 | 6 | 3 |
| Shewanella halifaxensis HAW-EB4 | 6 | 3 |
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | 6 | 3 |
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO1415 |
*
Shewanella oneidensis MR-1 Site: position = -238 score = 6.70644 sequence = ATTCGTGAGACGTCTCTTGAAT Gene: SO_1415: Transcriptional regulator, TetR family |
|
|
|
*
Shewanella sp MR-4 Site: position = -241 score = 6.43543 sequence = ATTCGTGAGTTATCTCGTGAAT Gene: Shewmr4_0298: Transcriptional regulator, TetR family |
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -235 score = 6.27259 sequence = ATTCGTGAACCATGTCCCGAAT Gene: Shew_0277: Transcriptional regulator, TetR family |
*
Shewanella pealeana ATCC 700345 Site: position = -247 score = 6.77856 sequence = ATTCGTGAGTCAGCTCTCGAAT Gene: Spea_0326: Transcriptional regulator, TetR family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -247 score = 6.68176 sequence = ATTCGTGAGGCAGCTCTCGAAT Gene: Shal_3965: Transcriptional regulator, TetR family |
|
*
Shewanella sediminis HAW-EB3 Site: position = -259 score = 5.87748 sequence = ATTCGTGAAGCAGATCTCGAAG Gene: Ssed_4183: Transcriptional regulator, TetR family |
|
Transcriptional regulator, TetR family |
| CRON 2. | |||||||||||||||||
| SO1414 |
*
Shewanella oneidensis MR-1 Site: position = -117 score = 6.70644 sequence = ATTCAAGAGACGTCTCACGAAT Gene: SO_1414: Flavocytochrome c flavin subunit |
|
|
|
*
Shewanella sp MR-4 Site: position = -116 score = 6.43543 sequence = ATTCACGAGATAACTCACGAAT Gene: Shewmr4_0299: Flavocytochrome c flavin subunit |
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -118 score = 6.27259 sequence = ATTCGGGACATGGTTCACGAAT Gene: Shew_0276: Flavocytochrome c flavin subunit |
*
Shewanella pealeana ATCC 700345 Site: position = -119 score = 6.77856 sequence = ATTCGAGAGCTGACTCACGAAT Gene: Spea_0325: Flavocytochrome c flavin subunit |
*
Shewanella halifaxensis HAW-EB4 Site: position = -119 score = 6.68176 sequence = ATTCGAGAGCTGCCTCACGAAT Gene: Shal_3966: Flavocytochrome c flavin subunit |
|
*
Shewanella sediminis HAW-EB3 Site: position = -116 score = 5.87748 sequence = CTTCGAGATCTGCTTCACGAAT Gene: Ssed_4184: Flavocytochrome c flavin subunit |
|
Flavocytochrome c flavin subunit |
| SO1413 |
Gene: SO_1413: Flavocytochrome c heme subunit |
|
|
|
Gene: Shewmr4_0300: Flavocytochrome c heme subunit |
|
|
|
|
|
Gene: Shew_0275: Flavocytochrome c heme subunit |
Gene: Spea_0324: Flavocytochrome c heme subunit |
Gene: Shal_3967: Flavocytochrome c heme subunit |
|
Gene: Ssed_4185: Flavocytochrome c heme subunit |
|
Flavocytochrome c heme subunit |
| SO1412 |
Gene: SO_1412: outer membrane beta barrel protein |
|
|
|
Gene: Shewmr4_0301: outer membrane beta barrel protein |
|
|
|
|
|
Gene: Shew_0274: outer membrane beta barrel protein |
Gene: Spea_0323: outer membrane beta barrel protein |
Gene: Shal_3968: outer membrane beta barrel protein |
|
Gene: Ssed_4186: outer membrane beta barrel protein |
|
outer membrane beta barrel protein |
| SO1411 |
Gene: SO_1411: conserved hypothetical outer membrane protein |
|
|
|
Gene: Shewmr4_0302: conserved hypothetical outer membrane protein |
|
|
|
|
|
Gene: Shew_0273: conserved hypothetical outer membrane protein |
Gene: Spea_0322: conserved hypothetical outer membrane protein |
Gene: Shal_3969: conserved hypothetical outer membrane protein |
|
Gene: Ssed_4187: conserved hypothetical outer membrane protein |
|
conserved hypothetical outer membrane protein |
| CRON 3. | |||||||||||||||||
| SO1410 |
*
Shewanella oneidensis MR-1 Site: position = -163 score = 5.82093 sequence = ATTCGCGAGTAAAGTCACGAAT Gene: SO_1410: periplasmic RmlC-type Cupin domain family protein |
|
|
|
*
Shewanella sp MR-4 Site: position = -149 score = 5.82093 sequence = ATTCGCGAGTAAAGTCACGAAT Gene: Shewmr4_0303: periplasmic RmlC-type Cupin domain family protein |
|
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -151 score = 6.34167 sequence = ATTCGCGAGCCAAGTCACGAAT Gene: Shew_0272: periplasmic RmlC-type Cupin domain family protein |
*
Shewanella pealeana ATCC 700345 Site: position = -157 score = 5.94785 sequence = ATTCGCGACCGAGCTCACGAAT Gene: Spea_0321: periplasmic RmlC-type Cupin domain family protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -156 score = 6.34167 sequence = ATTCGCGACTTGGCTCACGAAT Gene: Shal_3970: periplasmic RmlC-type Cupin domain family protein |
|
*
Shewanella sediminis HAW-EB3 Site: position = -154 score = 5.99514 sequence = ATTCGCGAGCTCTGTCACGAAT Gene: Ssed_4188: periplasmic RmlC-type Cupin domain family protein |
|
periplasmic RmlC-type Cupin domain family protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |