Regulon of SO1415 in Shewanella pealeana ATCC 700345

Properties
Regulator type:	Transcription factor
TF locus tag:	Spea_0326
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO1415 - Shewanellaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -247 Score: 6.8 Sequence: ATTCGTGAGTCAGCTCTCGAAT Locus tag: Spea_0326 Name: SO1415 Funciton: Transcriptional regulator, TetR family
	Spea_0326	SO1415	Transcriptional regulator, TetR family
Position: -157 Score: 5.9 Sequence: ATTCGCGACCGAGCTCACGAAT Locus tag: Spea_0321 Name: SO1410 Funciton: periplasmic RmlC-type Cupin domain family protein
	Spea_0321	SO1410	periplasmic RmlC-type Cupin domain family protein
Position: -119 Score: 6.8 Sequence: ATTCGAGAGCTGACTCACGAAT Locus tag: Spea_0325 Name: SO1414 Funciton: Flavocytochrome c flavin subunit Locus tag: Spea_0324 Name: SO1413 Funciton: Flavocytochrome c heme subunit Locus tag: Spea_0323 Name: SO1412 Funciton: outer membrane beta barrel protein Locus tag: Spea_0322 Name: SO1411 Funciton: conserved hypothetical outer membrane protein
	Spea_0325	SO1414	Flavocytochrome c flavin subunit
	Spea_0324	SO1413	Flavocytochrome c heme subunit
	Spea_0323	SO1412	outer membrane beta barrel protein
	Spea_0322	SO1411	conserved hypothetical outer membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD