Regulon of SO1415 in Shewanella sp MR-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr4_0298
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO1415 - Shewanellaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -149 Score: 5.8 Sequence: ATTCGCGAGTAAAGTCACGAAT Locus tag: Shewmr4_0303 Name: SO1410 Funciton: periplasmic RmlC-type Cupin domain family protein
	Shewmr4_0303	SO1410	periplasmic RmlC-type Cupin domain family protein
Position: -116 Score: 6.4 Sequence: ATTCACGAGATAACTCACGAAT Locus tag: Shewmr4_0299 Name: SO1414 Funciton: Flavocytochrome c flavin subunit Locus tag: Shewmr4_0300 Name: SO1413 Funciton: Flavocytochrome c heme subunit Locus tag: Shewmr4_0301 Name: SO1412 Funciton: outer membrane beta barrel protein Locus tag: Shewmr4_0302 Name: SO1411 Funciton: conserved hypothetical outer membrane protein
	Shewmr4_0299	SO1414	Flavocytochrome c flavin subunit
	Shewmr4_0300	SO1413	Flavocytochrome c heme subunit
	Shewmr4_0301	SO1412	outer membrane beta barrel protein
	Shewmr4_0302	SO1411	conserved hypothetical outer membrane protein
Position: -241 Score: 6.4 Sequence: ATTCGTGAGTTATCTCGTGAAT Locus tag: Shewmr4_0298 Name: SO1415 Funciton: Transcriptional regulator, TetR family
	Shewmr4_0298	SO1415	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD