Regulon of SO1415 in Shewanella loihica PV-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shew_0277
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO1415 - Shewanellaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -118 Score: 6.3 Sequence: ATTCGGGACATGGTTCACGAAT Locus tag: Shew_0276 Name: SO1414 Funciton: Flavocytochrome c flavin subunit Locus tag: Shew_0275 Name: SO1413 Funciton: Flavocytochrome c heme subunit Locus tag: Shew_0274 Name: SO1412 Funciton: outer membrane beta barrel protein Locus tag: Shew_0273 Name: SO1411 Funciton: conserved hypothetical outer membrane protein
	Shew_0276	SO1414	Flavocytochrome c flavin subunit
	Shew_0275	SO1413	Flavocytochrome c heme subunit
	Shew_0274	SO1412	outer membrane beta barrel protein
	Shew_0273	SO1411	conserved hypothetical outer membrane protein
Position: -235 Score: 6.3 Sequence: ATTCGTGAACCATGTCCCGAAT Locus tag: Shew_0277 Name: SO1415 Funciton: Transcriptional regulator, TetR family
	Shew_0277	SO1415	Transcriptional regulator, TetR family
Position: -151 Score: 6.3 Sequence: ATTCGCGAGCCAAGTCACGAAT Locus tag: Shew_0272 Name: SO1410 Funciton: periplasmic RmlC-type Cupin domain family protein
	Shew_0272	SO1410	periplasmic RmlC-type Cupin domain family protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD