Regulog SO0072 - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	7	2
Shewanella putrefaciens CN-32	7	2
Shewanella sp W3-18-1	7	2
Shewanella sp ANA-3	7	2
Shewanella sp MR-4	7	2
Shewanella sp MR-7	7	2
Shewanella baltica OS155	7	2
Shewanella denitrificans OS217	7	2
Shewanella frigidimarina NCIMB 400	7	2
Shewanella amazonensis SB2B	7	2
Shewanella loihica PV-4	7	2
Shewanella pealeana ATCC 700345	7	2
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3	6	2
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908	7	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO0072	* Shewanella oneidensis MR-1 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: SO_0072: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella putrefaciens CN-32 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Sputcn32_0058: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella sp W3-18-1 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Sputw3181_4020: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella sp ANA-3 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Shewana3_0077: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella sp MR-4 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Shewmr4_0075: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella sp MR-7 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Shewmr7_0073: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella baltica OS155 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Sbal_4277: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella denitrificans OS217 Site: position = -34 score = 6.86474 sequence = TGTATCAATGAATTAATACA Gene: Sden_0069: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella frigidimarina NCIMB 400 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Sfri_3976: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella amazonensis SB2B Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Sama_3574: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella loihica PV-4 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Shew_3779: Transcriptional regulator, GntR family, YtrA subfamily	* Shewanella pealeana ATCC 700345 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Spea_4189: Transcriptional regulator, GntR family, YtrA subfamily	Shewanella halifaxensis HAW-EB4	* Shewanella piezotolerans WP3 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: swp_0109: Transcriptional regulator, GntR family, YtrA subfamily	Shewanella sediminis HAW-EB3	* Shewanella woodyi ATCC 51908 Site: position = -34 score = 7.13616 sequence = TGTATCAATGTATTAATACA Gene: Swoo_4863: Transcriptional regulator, GntR family, YtrA subfamily	Transcriptional regulator, GntR family, YtrA subfamily
SO0073	Shewanella oneidensis MR-1 Gene: SO_0073: ABC transporter, ATP-binding protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_0059: ABC transporter, ATP-binding protein	Shewanella sp W3-18-1 Gene: Sputw3181_4019: ABC transporter, ATP-binding protein	Shewanella sp ANA-3 Gene: Shewana3_0078: ABC transporter, ATP-binding protein	Shewanella sp MR-4 Gene: Shewmr4_0076: ABC transporter, ATP-binding protein	Shewanella sp MR-7 Gene: Shewmr7_0074: ABC transporter, ATP-binding protein	Shewanella baltica OS155 Gene: Sbal_4276: ABC transporter, ATP-binding protein	Shewanella denitrificans OS217 Gene: Sden_0070: ABC transporter, ATP-binding protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3975: ABC transporter, ATP-binding protein	Shewanella amazonensis SB2B Gene: Sama_3573: ABC transporter, ATP-binding protein	Shewanella loihica PV-4 Gene: Shew_3778: ABC transporter, ATP-binding protein	Shewanella pealeana ATCC 700345 Gene: Spea_4188: ABC transporter, ATP-binding protein	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3 Gene: swp_0110: ABC transporter, ATP-binding protein	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_4862: ABC transporter, ATP-binding protein	ABC transporter, ATP-binding protein
SO0074	Shewanella oneidensis MR-1 Gene: SO_0074: ABC transporter permease protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_0060: ABC transporter permease protein	Shewanella sp W3-18-1 Gene: Sputw3181_4018: ABC transporter permease protein	Shewanella sp ANA-3 Gene: Shewana3_0079: ABC transporter permease protein	Shewanella sp MR-4 Gene: Shewmr4_0077: ABC transporter permease protein	Shewanella sp MR-7 Gene: Shewmr7_0075: ABC transporter permease protein	Shewanella baltica OS155 Gene: Sbal_4275: ABC transporter permease protein	Shewanella denitrificans OS217 Gene: Sden_0071: ABC transporter permease protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3974: ABC transporter permease protein	Shewanella amazonensis SB2B Gene: Sama_3572: ABC transporter permease protein	Shewanella loihica PV-4 Gene: Shew_3777: ABC transporter permease protein	Shewanella pealeana ATCC 700345 Gene: Spea_4187: ABC transporter permease protein	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3 Gene: swp_0111: ABC transporter permease protein	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_4861: ABC transporter permease protein	ABC transporter permease protein

CRON 2.
PF00561	* Shewanella oneidensis MR-1 Site: position = -78 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: SO0071: Hydrolase, alpha/beta hydrolase fold family	* Shewanella putrefaciens CN-32 Site: position = -79 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Sputcn32_0057: Hydrolase, alpha/beta hydrolase fold family	* Shewanella sp W3-18-1 Site: position = -79 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Sputw3181_4021: Hydrolase, alpha/beta hydrolase fold family	* Shewanella sp ANA-3 Site: position = -78 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Shewana3_0076: Hydrolase, alpha/beta hydrolase fold family	* Shewanella sp MR-4 Site: position = -78 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Shewmr4_0074: Hydrolase, alpha/beta hydrolase fold family	* Shewanella sp MR-7 Site: position = -78 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Shewmr7_0072: Hydrolase, alpha/beta hydrolase fold family	* Shewanella baltica OS155 Site: position = -79 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Sbal_4278: Hydrolase, alpha/beta hydrolase fold family	* Shewanella denitrificans OS217 Site: position = -73 score = 6.86474 sequence = TGTATTAATTCATTGATACA Gene: Sden_0068: Hydrolase, alpha/beta hydrolase fold family	* Shewanella frigidimarina NCIMB 400 Site: position = -80 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Sfri_3977: Hydrolase, alpha/beta hydrolase fold family	* Shewanella amazonensis SB2B Site: position = -75 score = 7.13616 sequence = TGTATTAATACATTGATACA Site: position = -83 score = 6.07634 sequence = TGAATCACTGTATTAATACA Gene: Sama_3575: Hydrolase, alpha/beta hydrolase fold family	* Shewanella loihica PV-4 Site: position = -101 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Shew_3780: Hydrolase, alpha/beta hydrolase fold family	* Shewanella pealeana ATCC 700345 Site: position = -76 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Spea_4190: Hydrolase, alpha/beta hydrolase fold family	Shewanella halifaxensis HAW-EB4 Gene: Shal_0062: Hydrolase, alpha/beta hydrolase fold family	* Shewanella piezotolerans WP3 Site: position = -133 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: swp_0108: Hydrolase, alpha/beta hydrolase fold family	Shewanella sediminis HAW-EB3 Gene: Ssed_4460: Hydrolase, alpha/beta hydrolase fold family	* Shewanella woodyi ATCC 51908 Site: position = -75 score = 7.13616 sequence = TGTATTAATACATTGATACA Gene: Swoo_4864: Hydrolase, alpha/beta hydrolase fold family	Hydrolase, alpha/beta hydrolase fold family
COG4555	Shewanella oneidensis MR-1 Gene: SO0070: Putative ABC-type Na+ transport system, ATPase component	Shewanella putrefaciens CN-32 Gene: Sputcn32_0056: Putative ABC-type Na+ transport system, ATPase component	Shewanella sp W3-18-1 Gene: Sputw3181_4022: Putative ABC-type Na+ transport system, ATPase component	Shewanella sp ANA-3 Gene: Shewana3_0075: Putative ABC-type Na+ transport system, ATPase component	Shewanella sp MR-4 Gene: Shewmr4_0073: Putative ABC-type Na+ transport system, ATPase component	Shewanella sp MR-7 Gene: Shewmr7_0071: Putative ABC-type Na+ transport system, ATPase component	Shewanella baltica OS155 Gene: Sbal_4279: Putative ABC-type Na+ transport system, ATPase component	Shewanella denitrificans OS217 Gene: Sden_0067: Putative ABC-type Na+ transport system, ATPase component	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3978: Putative ABC-type Na+ transport system, ATPase component	Shewanella amazonensis SB2B Gene: Sama_3576: Putative ABC-type Na+ transport system, ATPase component	Shewanella loihica PV-4 Gene: Shew_3781: Putative ABC-type Na+ transport system, ATPase component	Shewanella pealeana ATCC 700345 Gene: Spea_4191: Putative ABC-type Na+ transport system, ATPase component	Shewanella halifaxensis HAW-EB4 Gene: Shal_0061: Putative ABC-type Na+ transport system, ATPase component	Shewanella piezotolerans WP3 Gene: swp_0106: Putative ABC-type Na+ transport system, ATPase component	Shewanella sediminis HAW-EB3 Gene: Ssed_4461: Putative ABC-type Na+ transport system, ATPase component	Shewanella woodyi ATCC 51908 Gene: Swoo_4865: Putative ABC-type Na+ transport system, ATPase component	Putative ABC-type Na+ transport system, ATPase component
COG1668	Shewanella oneidensis MR-1 Gene: SO0069: Predicted ABC-type Na+ efflux pump, permease component	Shewanella putrefaciens CN-32 Gene: Sputcn32_0055: Predicted ABC-type Na+ efflux pump, permease component	Shewanella sp W3-18-1 Gene: Sputw3181_4023: Predicted ABC-type Na+ efflux pump, permease component	Shewanella sp ANA-3 Gene: Shewana3_0074: Predicted ABC-type Na+ efflux pump, permease component	Shewanella sp MR-4 Gene: Shewmr4_0072: Predicted ABC-type Na+ efflux pump, permease component	Shewanella sp MR-7 Gene: Shewmr7_0070: Predicted ABC-type Na+ efflux pump, permease component	Shewanella baltica OS155 Gene: Sbal_4280: Predicted ABC-type Na+ efflux pump, permease component	Shewanella denitrificans OS217 Gene: Sden_0066: Predicted ABC-type Na+ efflux pump, permease component	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3979: Predicted ABC-type Na+ efflux pump, permease component	Shewanella amazonensis SB2B Gene: Sama_3577: Predicted ABC-type Na+ efflux pump, permease component	Shewanella loihica PV-4 Gene: Shew_3782: Predicted ABC-type Na+ efflux pump, permease component	Shewanella pealeana ATCC 700345 Gene: Spea_4192: Predicted ABC-type Na+ efflux pump, permease component	Shewanella halifaxensis HAW-EB4 Gene: Shal_0060: Predicted ABC-type Na+ efflux pump, permease component	Shewanella piezotolerans WP3 Gene: swp_0105: Predicted ABC-type Na+ efflux pump, permease component	Shewanella sediminis HAW-EB3 Gene: Ssed_4462: Predicted ABC-type Na+ efflux pump, permease component	Shewanella woodyi ATCC 51908 Gene: Swoo_4866: Predicted ABC-type Na+ efflux pump, permease component	Predicted ABC-type Na+ efflux pump, permease component
SO0068	Shewanella oneidensis MR-1 Gene: SO0068: hypothetical protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_0054: hypothetical protein	Shewanella sp W3-18-1 Gene: Sputw3181_4024: hypothetical protein	Shewanella sp ANA-3 Gene: Shewana3_0073: hypothetical protein	Shewanella sp MR-4 Gene: Shewmr4_0071: hypothetical protein	Shewanella sp MR-7 Gene: Shewmr7_0069: hypothetical protein	Shewanella baltica OS155 Gene: Sbal_4281: hypothetical protein	Shewanella denitrificans OS217 Gene: Sden_0065: hypothetical protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3980: hypothetical protein	Shewanella amazonensis SB2B Gene: Sama_3578: hypothetical protein	Shewanella loihica PV-4 Gene: Shew_3783: hypothetical protein	Shewanella pealeana ATCC 700345 Gene: Spea_4193: hypothetical protein	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_4867: hypothetical protein	hypothetical protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SO0072 - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --